Prev. | NRCD Clone N | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00223

HP ID(1) HP00223
Gene ID(2) 4831
Gene Symbol finder NME2
Protein Name non-metastatic cells 2, protein (NM23B) expressed in
RefSeq NM_002512.2
Length of RefSeq (bp) 822
Chromosome 17q21.3
Reference DDBJ accession
UniGene

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe06A10 pKA1U5 GCTCCGCCGCCGGCTCCCGGGTGTGGTGGTCGCTCCAGCTCTCTGCTCTCCCAGCGCAGC
ARe29D03 pKA1U5 GCTGCTCTCCCAGCGCAGCGCCGCCGCCCGGCCCCTCCAGCTTCCCGGACCATGGCCAAC
ARe33G06 pKA1U5 GGGTGGTCGCTCCAGCTCTCTGCTCTCCCAGCGCAGNGCCGCCGCCCGGCCCCTCCAGCT
ARe38F01 pKA1U5 GGACTCCTCCCGTTCCCTCTTCCGCTTGCGCTGCCGCAGGTGGGCCCGGATCTGTGGGCG
ARe53F03 pKA1U5 GGCAGGACCATGGCCAACCTGGAGCGCACCTTCATCGCCATCAAGCCGGACGGCGTGCAG
ARe54A06 pKA1U5 ATCCTGGGCCCCTCCTCCGCCGCCGGCTCCCGGGTGTGGTGGTCGCTCCAGCTCTCTGCT
ARe55D06 pKA1U5 GCTCCTCCGCCGCCGGCTCCCGGGTGTGGTGGNCNCTCCAGCATCTCTGCTCTCCCAGCG
ARe60C03 pKA1U5 GGCCCCTCCTCCGCCGCCGGCTCCCGGGTGTGGTGGTCGCTCCAGCTCTCTGCTCTCCCA
ARe61G06 pKA1U5 GTCTCTGCTCTCCCAGCGCAGCGCCGCCGCCCGCCCTTNTCCAGCTTCCCGATAAGGCGG
ARe62F03 pKA1U5 GGGATCCCGCTCCCGCACCGCCATCATGATCTGCCTGGATGCTGACCATCTTCGCTAACC
ARe72C05 pKA1U5 GCTCCGCCGCCGGCTCCCGGGTGTGGTGGTCGCTCCAGCTCTCTGCTCTCCCAGCGCAGC
ARe94D09 pKA1U5 GGCTCTCCCAGCGCAGCGCCGCCGCCCGGCCCCTCCAGCTTCCCGGACCATGGCCAACCT
ARe96B12 pKA1U5 GCCTCCGCCGCCGGCTCCCGGGTGTGGTGGTCGCTCCAGCTCTCTGCTCTCCCAGCGCAG
ARe97H07 pKA1U5 GCCCTCCAGCTTCCCGGACCATGGCCAACCTGGAGCGCACCTTCATCGCCATCAAGCCGG
ARe99C02 pKA1U5 GGCCCTGCGCCCCTCCTCCGCCGCCGGCTCCCGGGTGTGGTGGTCGCTCCAGCTCTCTGC
ARf04A11 pKA1U5 GCTCCTCCGCCGCCGGCTCCCGGGTGTGGTGGTCGCTCCAGCTCTCTGCTCTCCCAGCGC
ARi23C12 pGCAP10 GCCCGGGTGTGGTGGTCGCTCCAGCTCTCTGCTCTCCCAGCGCAGCGCCGCCGCCCGGCC
ARi45C05 pGCAP10 GAGCGCAGCGCCGCCGCCCGGCCCCTCCAGCTTCCCGATAAGGCGGTGGGGGCGCATCCC
ARi46G04 pGCAP10 GCTCCTCCGCCGCCGGCTCCCGGGTGTGGTGGTCGCTCCAGCTCTCTGCTCTCCCAGCGC
ARi50F01 pGCAP10 TGCTCCGCCGCCGGCTCCCGGGTGTGGTGGTCGCTCCAGCTCTCTGCTCTCCCAGCGCAG
ARi71B08 pGCAP10 TGCTCCGCCGCCGGCTCCCGGGTGTGGTGGTCGCTCCAGCTCTCTGCTCTCCCAGCGCAG
ARiS013E02 pGCAP10 GGCTCCAGCTCTCTGCTCTCCCAGCGCAGCGCCGCCGCCCGGCCCCTCCAGCTTCCCGAT
ARiS023L06 pGCAP10 GCTGCGCCCGGGCCCTGACCGCACCTCTCGCCCCGCAGGACCATGGCCAACCTGGAGCGC
ARiS045P14 pGCAP10 GCTCCGCCGCCGGCTCCCGGGTGTGGTGGTCGCTCCAGCTCTCTGCTCTCCCAGCGCAGC
ARiS087H19 pGCAP10 NCCTCCGCGGGCCCCGCCANAGCCTGCGCCCGGGCCCTGACCGCACCTCTCGCCCCGCAG
ARiS087L19 pGCAP10
ARiS109M23 pGCAP10 GGCCCTGCNNCCCTCCTCCGCCGCCGGCTCCCGGGTGTGGTGGTCGCTCCAGCTCTCTGC
ARiS150I18 pGCAP10 GGCCCTGCGCCCCTCCTCCGCCGCCGGCTCCCGGGTGTGGTGGTCGCTCCAGCTCTCTGC
ARiS161I19 pGCAP10 GGTGGTGGTCGCTCCAGCTCTCTGCTCTCCCAGCGCAGCGCCGCCGCCCGGCCCCTCCAG
RBb07B11 pKA1U5 GCTCCGCCGCCGGCTCCCGGGTGTGGTGGTCGCACCAGCTCTCTGCTCTCCCAGCGCAGC
RBb09H02 pKA1U5 GCTCCTCCGCCGCCGGCTCCCGGGTGTGGTGGTCGNTCCAGCTCTCTGCTCTCCCAGCGC
RBb15C03 pKA1U5 GCTCCGCCGCCGGCTCCCGGGTGTGGTGGTCGCTCCAGCTCTCTGCTCTCCCAGCGCAGC
RBb18G02 pKA1U5 GCCCTCCAGCTTCCCGGACCATGGCCAACCTGGCANCNTACCTTCATCGCCATCAAGCCG
RBb21H05 pKA1U5 ATCCTGGCCCTCCTCCGCCGCCGGCTCCCGGGTGTGNTGGTCGCACCAGCTCTCTGCTCT
RBb23B01 pGCAP1 GCTCCGCCGCCGGCTCCCGGGTGTGGTGGTCGCACCAGCTCTCTGCTCTCCCAGCGCAGC
RBb34F04 pGCAP1 GCTCCTCCGCCGCCGGCTCCCGGGTGTGGTGGTCGCTCCAGCTCTCTGCTCTCCCAGCGC
RBb42A11 pGCAP1 GGCTCTCCCAGCGCAGCGCCGCCGCCCGGCCCCTCCAGCTTCCCGGACCATGGCCAACCT
RBb46B03 pGCAP1
RBb54H09 pGCAP1 GCTCCGCCGCCGGCTCCCGGGTGTGGTGGTCGCTCCAGCTCTCTGCTCTCCCAGCGCAGC
RBb58F04 pGCAP1 GCTCCTCCGCCGCCGGCTCCCGGGTGTGGTGGTCGCACCAGCTCTCTGCTCTCCCAGCGC
RBb66G10 pGCAP1 GCTCTGCTCTCCCAGCGCAGCGCCGCCGCCCGGCCCCTCCAGCTTCCCGGACCATGGCCA
RBb70C04 pGCAP1 GTCTTCCGCTTGCGCTGCCGCAGGACCATGGCCAACCTGGAGCGCACCTTCATCGCCATC
RBd01A05 pGCAP10 GGCAGCGCCGCCGCCCGGCCCCTCCAGCTTCCCGGACCATGGCCAACCTGGAGCGCACCT
RBd19H10 pGCAP10 GGCTCTCCCAGCGCAGCGCCGCCGCCCGGCCCCTCCAGCTTCCCGGACCATGGCCAACCT
RBd45F12 pGCAP10 GCTCTCCGCCGCCGGCTCCCGGGTGTGGTGGTCGCTCCAGCTCTCTGCTCTCCCAGCGCA
RBd56C01 pGCAP10 GGCGCTCCGCCCTGCGCCCCTCCTCCGCCGCCGGCTCCCGGGTGTGGTGGTCGCTCCAGC
RBd58A08 pGCAP10 GAGCGCAGCGCCGCCGCCCGGCCCCTCCAGCTTCCCGGTAANNNNNNNNNGGCGCATCCC
RBd74H11 pGCAP10 GAGCGCAGCGCCGCCGCCCGGCCCCTCCAGCTTCCCGGACCATGGCCAACCTGGAGCGCA
RBd77C09 pGCAP10 GCTCCGCCGCCGGCTCCCGGGTGTGGTGGTCGCTCCAGCTCTCTGCTCTCCCAGCGCAGC
RBd82G10 pGCAP10 GCTCCGCCGCCGGCTCCCGGGTGTGGTGGTCGCACCAGCTCTCTGCTCTCCCAGCGCAGC
RBdS007D19 pGCAP10 CGGCCGGCCGATGCGGCTCCCGGGTGTGGTGGTCGCACCAGCTCTCTGCTCTCCCAGCGC
RBdS013K04 pGCAP10 TGGGGTGTGGTGGTCNCACCAGCTCTCTGCTCTCCCAGCGCAGCGCCGCCGCCCGGCCCC
RBdS015P08 pGCAP10 GGGTGGGGGCGCATCCCCTGGCGACTCCTCCCGTTCCCTCTTCCGCTTGCGCTGCCGCAG
RBdS070D19 pGCAP10 GCTGCTCTCCCAGCGCAGCGCCGCCGCCCGGCCCCTCCAGCTTCCCGGACCATGGCCAAC
RBdS081P07 pGCAP10 GGCTCTCCCAGCGCAGCGCCGCCGCCCGGCCCCTCCAGCTTCCCGGACCATGGCCAACCT
RBdS104C16 pGCAP10 GCCCTCCTCCGCCGCCGGCTCCCGGGTGTGGTGGTCGCACCAGCTCTCTGCTCTCCCAGC
RBdS105G20 pGCAP10 TGGACTCCTCCCGTTCCCTCTTCCGCTTGCGCTGCCGCAGGACCATGGCCAACCTGGAGC
RBdS110A16 pGCAP10 GGTCGCACCAGCTCTCTGCTCTCCCAGCGCAGCGCCGCCGCCCGGCCCCTCCAGCTTCCC
RBdS132I06 pGCAP10 GCTCCGCCGCCGGCTCCCGGGTGTGGTGGTCGCTCCAGCTCTCTGCTCTCCCAGCGCAGC
RBdS177H09 pGCAP10 GGCTCTCCCAGCGCANCGCCGCCGCCCGGCCCCTCCAGCTTCCCGGACCATGGCCAACCT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl