Prev. | Human A to Z list > N > 

RIKEN DNA Bank Human Resource - NME2

Gene ID (NCBI) 4831
Gene Symbol NME2
Protein Name NME/NM23 nucleoside diphosphate kinase 2
Synonyms NDKB|NDPK-B|NDPKB|NM23-H2|NM23B|PUF
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Ortholog resources in the DNA Bank (KEGG orthology K00940)


Genome Network Project (GNP) Human cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY082188 IRAL005H20 pOTB7 BC002476 NM_001018139 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


NRCD Human cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR042410 ARe06A10 pKA1U5 NM_002512.2  
GCTCCGCCGCCGGCTCCCGGGTGTGGTGGTCGCTCCAGCTCTCTGCTCTCCCAGCGCAGC
HKR081611 ARf04A11 pKA1U5 NM_002512.2  
GCTCCTCCGCCGCCGGCTCCCGGGTGTGGTGGTCGCTCCAGCTCTCTGCTCTCCCAGCGC
HKR051675 ARe29D03 pKA1U5 NM_002512.2  
GCTGCTCTCCCAGCGCAGCGCCGCCGCCCGGCCCCTCCAGCTTCCCGGACCATGGCCAAC
HKR169260 ARi23C12 pGCAP10 NM_002512.2  
GCCCGGGTGTGGTGGTCGCTCCAGCTCTCTGCTCTCCCAGCGCAGCGCCGCCGCCCGGCC
HKR053350 ARe33G06 pKA1U5 NM_002512.2  
GGGTGGTCGCTCCAGCTCTCTGCTCTCCCAGCGCAGNGCCGCCGCCCGGCCCCTCCAGCT
HKR055321 ARe38F01 pKA1U5 NM_002512.2  
GGACTCCTCCCGTTCCCTCTTCCGCTTGCGCTGCCGCAGGTGGGCCCGGATCTGTGGGCG
HKR178053 ARi45C05 pGCAP10 NM_002512.2  
GAGCGCAGCGCCGCCGCCCGGCCCCTCCAGCTTCCCGATAAGGCGGTGGGGGCGCATCCC
HKR178548 ARi46G04 pGCAP10 NM_002512.2  
GCTCCTCCGCCGCCGGCTCCCGGGTGTGGTGGTCGCTCCAGCTCTCTGCTCTCCCAGCGC
HKR061323 ARe53F03 pKA1U5 NM_002512.2  
GGCAGGACCATGGCCAACCTGGAGCGCACCTTCATCGCCATCAAGCCGGACGGCGTGCAG
HKR061606 ARe54A06 pKA1U5 NM_002512.2  
ATCCTGGGCCCCTCCTCCGCCGCCGGCTCCCGGGTGTGGTGGTCGCTCCAGCTCTCTGCT
HKR062078 ARe55D06 pKA1U5 NM_002512.2  
GCTCCTCCGCCGCCGGCTCCCGGGTGTGGTGGNCNCTCCAGCATCTCTGCTCTCCCAGCG
HKR180121 ARi50F01 pGCAP10 NM_002512.2  
TGCTCCGCCGCCGGCTCCCGGGTGTGGTGGTCGCTCCAGCTCTCTGCTCTCCCAGCGCAG
HKR064051 ARe60C03 pKA1U5 NM_002512.2  
GGCCCCTCCTCCGCCGCCGGCTCCCGGGTGTGGTGGTCGCTCCAGCTCTCTGCTCTCCCA
HKR064550 ARe61G06 pKA1U5 NM_002512.2  
GTCTCTGCTCTCCCAGCGCAGCGCCGCCGCCCGCCCTTNTCCAGCTTCCCGATAAGGCGG
HKR064923 ARe62F03 pKA1U5 NM_002512.2  
GGGATCCCGCTCCCGCACCGCCATCATGATCTGCCTGGATGCTGACCATCTTCGCTAACC
HKR068853 ARe72C05 pKA1U5 NM_002512.2  
GCTCCGCCGCCGGCTCCCGGGTGTGGTGGTCGCTCCAGCTCTCTGCTCTCCCAGCGCAGC
HKR188432 ARi71B08 pGCAP10 NM_002512.2  
TGCTCCGCCGCCGGCTCCCGGGTGTGGTGGTCGCTCCAGCTCTCTGCTCTCCCAGCGCAG
HKR077681 ARe94D09 pKA1U5 NM_002512.2  
GGCTCTCCCAGCGCAGCGCCGCCGCCCGGCCCCTCCAGCTTCCCGGACCATGGCCAACCT
HKR078436 ARe96B12 pKA1U5 NM_002512.2  
GCCTCCGCCGCCGGCTCCCGGGTGTGGTGGTCGCTCCAGCTCTCTGCTCTCCCAGCGCAG
HKR078975 ARe97H07 pKA1U5 NM_002512.2  
GCCCTCCAGCTTCCCGGACCATGGCCAACCTGGAGCGCACCTTCATCGCCATCAAGCCGG
HKR079650 ARe99C02 pKA1U5 NM_002512.2  
GGCCCTGCGCCCCTCCTCCGCCGCCGGCTCCCGGGTGTGGTGGTCGCTCCAGCTCTCTGC
HKR205298 ARiS013E02 pGCAP10 NM_002512.2  
GGCTCCAGCTCTCTGCTCTCCCAGCGCAGCGCCGCCGCCCGGCCCCTCCAGCTTCCCGAT
HKR209470 ARiS023L06 pGCAP10 NM_002512.2  
GCTGCGCCCGGGCCCTGACCGCACCTCTCGCCCCGCAGGACCATGGCCAACCTGGAGCGC
HKR218374 ARiS045P14 pGCAP10 NM_002512.2  
GCTCCGCCGCCGGCTCCCGGGTGTGGTGGTCGCTCCAGCTCTCTGCTCTCCCAGCGCAGC
HKR234987 ARiS087H19 pGCAP10 NM_002512.2  
NCCTCCGCGGGCCCCGCCANAGCCTGCGCCCGGGCCCTGACCGCACCTCTCGCCCCGCAG
HKR235083 ARiS087L19 pGCAP10 NM_002512.2  
HKR243911 ARiS109M23 pGCAP10 NM_002512.2  
GGCCCTGCNNCCCTCCTCCGCCGCCGGCTCCCGGGTGTGGTGGTCGCTCCAGCTCTCTGC
HKR260210 ARiS150I18 pGCAP10 NM_002512.2  
GGCCCTGCGCCCCTCCTCCGCCGCCGGCTCCCGGGTGTGGTGGTCGCTCCAGCTCTCTGC
HKR264611 ARiS161I19 pGCAP10 NM_002512.2  
GGTGGTGGTCGCTCCAGCTCTCTGCTCTCCCAGCGCAGCGCCGCCGCCCGGCCCCTCCAG
HKR322835 RBb07B11 pKA1U5 NM_002512.2  
GCTCCGCCGCCGGCTCCCGGGTGTGGTGGTCGCACCAGCTCTCTGCTCTCCCAGCGCAGC
HKR323770 RBb09H02 pKA1U5 NM_002512.2  
GCTCCTCCGCCGCCGGCTCCCGGGTGTGGTGGTCGNTCCAGCTCTCTGCTCTCCCAGCGC
HKR360405 RBd01A05 pGCAP10 NM_002512.2  
GGCAGCGCCGCCGCCCGGCCCCTCCAGCTTCCCGGACCATGGCCAACCTGGAGCGCACCT
HKR326051 RBb15C03 pKA1U5 NM_002512.2  
GCTCCGCCGCCGGCTCCCGGGTGTGGTGGTCGCTCCAGCTCTCTGCTCTCCCAGCGCAGC
HKR327346 RBb18G02 pKA1U5 NM_002512.2  
GCCCTCCAGCTTCCCGGACCATGGCCAACCTGGCANCNTACCTTCATCGCCATCAAGCCG
HKR367778 RBd19H10 pGCAP10 NM_002512.2  
GGCTCTCCCAGCGCAGCGCCGCCGCCCGGCCCCTCCAGCTTCCCGGACCATGGCCAACCT
HKR328573 RBb21H05 pKA1U5 NM_002512.2  
ATCCTGGCCCTCCTCCGCCGCCGGCTCCCGGGTGTGNTGGTCGCACCAGCTCTCTGCTCT
HKR329225 RBb23B01 pGCAP1 NM_002512.2  
GCTCCGCCGCCGGCTCCCGGGTGTGGTGGTCGCACCAGCTCTCTGCTCTCCCAGCGCAGC
HKR333724 RBb34F04 pGCAP1 NM_002512.2  
GCTCCTCCGCCGCCGGCTCCCGGGTGTGGTGGTCGCTCCAGCTCTCTGCTCTCCCAGCGC
HKR336811 RBb42A11 pGCAP1 NM_002512.2  
GGCTCTCCCAGCGCAGCGCCGCCGCCCGGCCCCTCCAGCTTCCCGGACCATGGCCAACCT
HKR338427 RBb46B03 pGCAP1 NM_002512.2  
HKR378132 RBd45F12 pGCAP10 NM_002512.2  
GCTCTCCGCCGCCGGCTCCCGGGTGTGGTGGTCGCTCCAGCTCTCTGCTCTCCCAGCGCA
HKR341777 RBb54H09 pGCAP1 NM_002512.2  
GCTCCGCCGCCGGCTCCCGGGTGTGGTGGTCGCTCCAGCTCTCTGCTCTCCCAGCGCAGC
HKR343324 RBb58F04 pGCAP1 NM_002512.2  
GCTCCTCCGCCGCCGGCTCCCGGGTGTGGTGGTCGCACCAGCTCTCTGCTCTCCCAGCGC
HKR382449 RBd56C01 pGCAP10 NM_002512.2  
GGCGCTCCGCCCTGCGCCCCTCCTCCGCCGCCGGCTCCCGGGTGTGGTGGTCGCTCCAGC
HKR383208 RBd58A08 pGCAP10 NM_002512.2  
GAGCGCAGCGCCGCCGCCCGGCCCCTCCAGCTTCCCGGTAANNNNNNNNNGGCGCATCCC
HKR346554 RBb66G10 pGCAP1 NM_002512.2  
GCTCTGCTCTCCCAGCGCAGCGCCGCCGCCCGGCCCCTCCAGCTTCCCGGACCATGGCCA
HKR348052 RBb70C04 pGCAP1 NM_002512.2  
GTCTTCCGCTTGCGCTGCCGCAGGACCATGGCCAACCTGGAGCGCACCTTCATCGCCATC
HKR389779 RBd74H11 pGCAP10 NM_002512.2  
GAGCGCAGCGCCGCCGCCCGGCCCCTCCAGCTTCCCGGACCATGGCCAACCTGGAGCGCA
HKR390857 RBd77C09 pGCAP10 NM_002512.2  
GCTCCGCCGCCGGCTCCCGGGTGTGGTGGTCGCTCCAGCTCTCTGCTCTCCCAGCGCAGC
HKR392954 RBd82G10 pGCAP10 NM_002512.2  
GCTCCGCCGCCGGCTCCCGGGTGTGGTGGTCGCACCAGCTCTCTGCTCTCCCAGCGCAGC
HKR402891 RBdS007D19 pGCAP10 NM_002512.2  
CGGCCGGCCGATGCGGCTCCCGGGTGTGGTGGTCGCACCAGCTCTCTGCTCTCCCAGCGC
HKR405444 RBdS013K04 pGCAP10 NM_002512.2  
TGGGGTGTGGTGGTCNCACCAGCTCTCTGCTCTCCCAGCGCAGCGCCGCCGCCCGGCCCC
HKR406368 RBdS015P08 pGCAP10 NM_002512.2  
GGGTGGGGGCGCATCCCCTGGCGACTCCTCCCGTTCCCTCTTCCGCTTGCGCTGCCGCAG
HKR428091 RBdS070D19 pGCAP10 NM_002512.2  
GCTGCTCTCCCAGCGCAGCGCCGCCGCCCGGCCCCTCCAGCTTCCCGGACCATGGCCAAC
HKR432767 RBdS081P07 pGCAP10 NM_002512.2  
GGCTCTCCCAGCGCAGCGCCGCCGCCCGGCCCCTCCAGCTTCCCGGACCATGGCCAACCT
HKR441664 RBdS104C16 pGCAP10 NM_002512.2  
GCCCTCCTCCGCCGCCGGCTCCCGGGTGTGGTGGTCGCACCAGCTCTCTGCTCTCCCAGC
HKR442164 RBdS105G20 pGCAP10 NM_002512.2  
TGGACTCCTCCCGTTCCCTCTTCCGCTTGCGCTGCCGCAGGACCATGGCCAACCTGGAGC
HKR444016 RBdS110A16 pGCAP10 NM_002512.2  
GGTCGCACCAGCTCTCTGCTCTCCCAGCGCAGCGCCGCCGCCCGGCCCCTCCAGCTTCCC
HKR452998 RBdS132I06 pGCAP10 NM_002512.2  
GCTCCGCCGCCGGCTCCCGGGTGTGGTGGTCGCTCCAGCTCTCTGCTCTCCCAGCGCAGC
HKR470977 RBdS177H09 pGCAP10 NM_002512.2  
GGCTCTCCCAGCGCANCGCCGCCGCCCGGCCCCTCCAGCTTCCCGGACCATGGCCAACCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.06.01

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl