Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00222

HP ID(1) HP00222
Gene ID(2) 10376
Gene Symbol finder TUBA1B
Protein Name tubulin, alpha 1b
RefSeq NM_006082.2
Length of RefSeq (bp) 1771
Chromosome 12q13.12
Reference DDBJ accession
UniGene Hs.524390

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe03C07 pKA1U5 GAGTGCGTTACTTACCTCGACTCTTAGCTTGTCGGGGACGGTAACCGGGACCCGGTGTCT
ARe14D03 pKA1U5 GAGTGCGTTACTTACCTCGACTCTTAGCTTGTCGGGGACGGTAACCGGGACCCGGTGTCT
ARe37H12 pKA1U5 GAGTGCGTTACTTACCTCGACTCTTAGCTTGTCGGGGACGGTAACCGGGACCCGGTGTCT
ARe38E01 pKA1U5 GCTAGTGCGTTACTTACCTCGACTCTTAGCTTGTCGGGGACGGTAACCGGGACCCGGTGT
ARe44D06 pKA1U5 GAGTGCGTTACTTACCTCGACTCTTAGCTTGTCGGGGACGGTAACCGGGACCCGGTGTCT
ARe44E04 pKA1U5 GAGTGCGTTACTTACCTCGACTCTTAGCTTGTCNGGNTACGGTAACCGGGACCCGGTGTC
ARe49F09 pKA1U5 GAGTGCGTTACTTACCTCGACTCTTAGCTTGTCGGGGACGGTAACCGGGACCCGGTGTCT
ARe64H09 pKA1U5 GCTAGTGCGTTACTTACCTCGACTCTTTAGCTTGCTCGGGGACGGTAACCGGGACCCGGN
ARe66C06 pKA1U5 GAGTGCGTTTACTTACCTCGACTCTTAGCTTGTCGGGGACGGTAACCGGGACCCGGTGTC
ARe75F01 pKA1U5 GCTAGATGCGTTACTTACCTCGACTCTTAGCTTGCTCGGGGACGGTAACCGGGACCCGGN
ARe79F12 pKA1U5 ATCCTGAGTGCGTTACTTACCTCGACTCTTAGCTTGTCGGGGACGGTAACCGGGACCCGG
ARi03H03 pGCAP10 GGCGTTACTTACCTCGACTCTTAGCTTGTCGGGGACGGTAACCGGGACCCGGTGTCTGCT
ARi24F11 pGCAP10 TTGGTGAGTGCGTTACTTACCTCGACTCTTAGCTTGTCGGGGACGGTAACCGGGACCCGG
ARi33D12 pGCAP10 GAGTGCGTTACTTACCTCGACTCTTAGCTTGTCGGGGACGGTAACCGGGACCCGGTGTCT
ARi38F05 pGCAP10 GCTAGTGCGTTACTTACCTCGACTCTTAGCTTGTCGGGGACGGTAACCGGGACCCGGTGT
ARi41B08 pGCAP10 GAGTGCGTTACTTACCTCGACTCTTAGCTTGTCGGGGACGGTAACCGGGACCCGGTGTCT
ARi49D03 pGCAP10 GAGTGCGTTACTTACCTCGACTCTTAGCTTGTCGGGGACGGTAACCGGGACCCGGTGTCT
ARi61C08 pGCAP10 GAGTGCGTTACTTACCTCGACTCTTAGCTTGTCGGGGACGGTAACCGGGACCCGGTGTCT
ARi65F11 pGCAP10 GAGTGCGTTACTTACCTCGACTCTTAGCTTGTCGGGGACGGTAACCGGGACCCGGTGTCT
ARi68B07 pGCAP10 GAGTGCGTTACTTACCTCGACTCTTAGCTTGTCGGGGACGGTAACCGGGACCCGGTGTCT
ARi69C01 pGCAP10 GAGTGCGTTACTTACCTCGACTCTTAGCTTGTCGGGGACGGTAACCGGGACCCGGTGTCT
ARiS045F20 pGCAP10 GAGTGCGTTACTTACCTCGACTCTTAGCTTGTCGGGGACGGTAACCGGGACCCGGTGTCT
ARiS045J03 pGCAP10 TGAGTGCGTTACTTACCTCGACTCTTAGCTTGTCGGGGACGGTAACCGGGACCCGGTGTC
ARiS045L11 pGCAP10
ARiS085K05 pGCAP10 GAGTGCGTTACTTACCTCGACTCTTAGCTTGTCGGGGACGGTAACCGGGACCCGGTGTCT
ARiS087E15 pGCAP10 GCTAGTGCGTTACTTACCTCGACTCTTAGCTTGTCGGGGACGGTAACCGGGACCCGGTGT
ARiS088E23 pGCAP10 GAGTGCGTTACTTACCTCGACTCTTAGCTTGTCGGGGACGGTAACCGGGACCCGGTGTCT
ARiS109B02 pGCAP10 TGAGTGCGTTACTTACCTCGACTCTTAGCTTGTCGGGGACGGTAACCGGGACCCGGTGTC
ARiS109G22 pGCAP10 TGAGTGCGTTACTTACCTCGACTCTTAGCTTGTCGGGGACGGTAACCGGGACCCGGTGTC
ARiS122J11 pGCAP10 GAGTGCGTTACTTACCTCGACTCTTAGCTTGTCGGGGACGGTAACCGGGACCCGGTGTCT
ARiS191J24 pGCAP10 GAGTGCGTTACTTACCTCGACTCTTAGCTTGTCGGGGACGGTAACCGGGACCCGGTGTCT
ARiS191K10 pGCAP10 GCTAGTGCGTTACTTACCTCGACTCTTAGCTTGTCGGGGACGGTAACCGGGACCCGGTGT
RBb04E03 pKA1U5 AGTGCGTTACTTACCTCGACTCTTAGCTTGTCGGGGACGGTAACCGGGACCCGGTGTCTG
RBb15C11 pKA1U5 GAGTGCGTTACTTACCTCGACTCTTAGCTTGTCGGGGACGGTAACCGGGACCCGGTGTCT
RBb16H12 pKA1U5 GAGTGCGTTACTTACCTCGACTCTTAGCTTGTCGGGGACGGTAACCGGGACCCGGTGTCT
RBb20G08 pKA1U5 GCTAGTGCGTTACTTACCTCGACTCTTAGCTTGTCGGGGACGGTAACCGGGACCCGGTGT
RBb24H07 pGCAP1 TGGCTAGTGCGTTTACTTACCTCGACTCTTAGCTTGTCGGGGACGGTAACCGGGACCCGG
RBb48E08 pGCAP1 AGTGCGTTACTTACCTCGCACTCTTAGCTTGTCGGGGACGGTAACCGGGACCCGGTGTCT
RBb58G02 pGCAP1 GAGTGCGTTACTTACCTCGACTCTTAGCTTGTCGGGGACGGTAACCGGGACCCGGTGTCT
RBd02C06 pGCAP10 GAGTGCGTTACTTACCTCGACTCTTAGCTTGTCGGGGACGGTAACCGGGACCCGGTGTCT
RBd03B03 pGCAP10 TGAGTGCGTTACTTACCTCGACTCTTAGCTTGTCGGGGACGGTAACCGGGACCCGGTGTC
RBd03G05 pGCAP10 GGCAGGTTCTCTTACATCGACCGCCTAAGAGTCGCGCTGTAAGAAGCAACAACCTCTCCT
RBd05F12 pGCAP10 GAGTGCGTTACTTACCTCGACTCTTAGCTTGTCGGGGACGGTAACCGGGACCCGGTGTCT
RBd07D05 pGCAP10 GGCAGGTTCTCTTACATCGACCGCCTAAGAGTCGCGCTGTAAGAAGCAACAACCTCTCCT
RBd07E12 pGCAP10 GGCCTAAGAGTCGCGCTGTAAGAAGCAACAACCTCTCCTCTTCGTCTCCGCCATCAGCTC
RBd08F01 pGCAP10 GGCAGGTTCTCTTACATCGACCGCCTAAGAGTCGCGCTGTAAGAAGCAACAACCTCTCCT
RBd18A06 pGCAP10 GGCAGGTTCTCTTACATCGACCGCCTAAGAGTCGCGCTGTAAGAAGCAACAACCTCTCCT
RBd32H12 pGCAP10 GAGTGCGTTACTTACCTCGACTCTTAGCTTGTCGGGGACGGTAACCGGGACCCGGTGTCT
RBd41E06 pGCAP10 GAGTGCGTTACTTACCTCGACTCTTAGCTTGTCGGGGACGGTAACCGGGACCCGGTGTCT
RBd49D02 pGCAP10 GGCAGGTTCTCTTACATCGACCGCCTAAGAGTCGCGCTGTAAGAAGCAACAACCTCTCCT
RBd50D11 pGCAP10 GCTAGTGCGTTACTTACCTCGACTCTTAGCTTGTCGGGGACGGTAACCGGGACCCGGTGT
RBd52B06 pGCAP10 GAGTGCGTTACTTACCTCGACTCTTAGCTTGTCGGGGACGGTAACCGGGACCCGGTGTCT
RBd57C10 pGCAP10 GGTTACTTACCTCGACTCTTAGCTTGTCGGGGACGGTAACCGNNNNCCGGTGTCTGCTCC
RBd59F04 pGCAP10 GGCAGGTTCTCTTACATCGACCGCCTAAGAGTCGCGCTGTAAGAAGCAACAACCTCTCCT
RBd64E02 pGCAP10 GAGTGCGTTACTTACCTCGACTCTTAGCTTGTCGGGGACGGTAACCGGGACCCGGTGTCT
RBd64G06 pGCAP10 GAGTGCGTTACTTACCTCGACTCTTAGCTTGTCGGGGACGGTAACCGGGACCCGGTGTCT
RBd66H01 pGCAP10 GAGTGNGTTACTTACCTCGACTCTTAGCTTGTCGGGGACGGTAACCGGGACCCGGTGTCT
RBd71G05 pGCAP10 GGCAGGTTCTCTTACATCGACCGCCTAAGAGTCGCGCTGTAAGAAGCAACAACCTCTCCT
RBd71H11 pGCAP10 GAGTGCGTTACTTACCTCGACTCTTAGCTTGTCGGGGACGGTAACCGGGACCCGGTGTCT
RBd76G01 pGCAP10 GAGTGCGTTACTTACCTCGACTCTTAGCTTGTCGGGGACGGTAACCGGGACCCGGTGTCT
RBd78B10 pGCAP10 GGCAGGTTCTCTTACATCGACCGCCTAAGAGTCGCGCTGTAAGAAGCAACAACCTCTCCT
RBd83D07 pGCAP10 TGGAGTGCGTTACTTACCTCGACTCTTAGCTTGTCGGGGACGGTAACCGGGACCCGGTGT
RBd85A04 pGCAP10 AGGAGTGCGTTACTTACCTCGACTCTTAGCTTGTCGGGGACGGTAACCGGGACCCGGTGT
RBd89E06 pGCAP10 GAGGGTTCTCTTACATCGACCGCCTAAGAGTCGCGCTGTAAGAAGCAACAACCTCTCCTC
RBd91C12 pGCAP10 GAGTGCGTTACTTACCTCGACTCTTAGCTTGTCGGGGACGGTAACCGGGACCCGGTGTCT
RBd91D05 pGCAP10 GACTTACCTCGACTCTTAGCTTGTCGGGGACGGTAACCGGGACCCGGTGTCTGCTCCTGT
RBd94G05 pGCAP10 GGCAGGTTCTCTTACATCGACCGCCTAAGAGTCGCGCTGTAAGAAGCAACAACCTCTCCT
RBdS013N03 pGCAP10 GGCAGGTTCTCTTACATCGACCGCCTAAGAGTCGCGCTGTAAGAAGCAACAACCTCTCCT
RBdS014A18 pGCAP10 CGGCCGGCCGATGGCAGGTTCTCTTACATCGACCGCCTAAGAGTCGCGCTGTAAGAAGCA
RBdS015A20 pGCAP10 GAGTGCGTTACTTACCTCGACTCTTAGCTTGTCGGGGACGGTAACCGGGACCCGGTGTCT
RBdS040E10 pGCAP10 GAGTGCGTTACTTACCTCGACTCTTAGCTTGTCGGGGACGGTAACCGGGACCCGGTGTCT
RBdS051D08 pGCAP10 GAGTGCGTTACTTACCTCGACTCTTAGCTTGTCGGGGACGGTAACCGGGACCCGGTGTCT
RBdS070M19 pGCAP10 GAGTGCGTTACTTACCTCGACTCTTAGCTTGTCGGGGACGGTAACCGGGACCCGGTGTCT
RBdS075B12 pGCAP10 GAGTGCGTTACTTACCTCGACTCTTAGCTTGTCGGGGACGGTAACCGGGACCCGGTGTCT
RBdS075C14 pGCAP10 GAGTGCGTTACTTACCTCGACTCTTAGCTTGTCGGGGACGGTAACCGGGACCCGGTGTCT
RBdS081H03 pGCAP10 GAGGTTCTCTTACATCGACCGCCTAAGAGTCGCGCTGTAAGAAGCAACAACCTCTCCTCT
RBdS081K04 pGCAP10 GAGTGCGTTACTTACCTCGACTCTTAGCTTGTCGGGGACGGTAACCGGGACCCGGTGTCT
RBdS083O21 pGCAP10 GGCAGGTTCTCTTACATCGACCGCCTAAGAGTCGCGCTGTAAGAAGCAACAACCTCTCCT
RBdS083P23 pGCAP10 GAGTGCGTTACTTACCTCGACTCTTAGCTTGTCGGGGACGGTAACCGGGACCCGGTGTCT
RBdS104B11 pGCAP10 GCTAGTGCGTTACTTACCTCGACTCTTAGCTTGTCGGGGACGGTAACCGGGACCCGGTGT
RBdS104F03 pGCAP10 GAGTGCGTTACTTACCTCGACTCTTAGCTTGTCGGGGACGGTAACCGGGACCCGGTGTCT
RBdS104L13 pGCAP10 GAGTGCGTTACTTACCTCGACTCTTAGCTTGTCGGGGACGGTAACCGGGACCCGGTGTCT
RBdS105D20 pGCAP10 GGCAGGTTCTCTTACATCGACCGCCTAAGAGTCGCGCTGTAAGAAGCAACAACCTCTCCT
RBdS110P11 pGCAP10 GAGTGCGTTACTTACCTCGACTCTTAGCTTGTCGGGGACGGTAACCGGGACCCGGTGTCT
RBdS154I04 pGCAP10 GAGTGCGTTACTTACCTCGACTCTTAGCTTGTCGGGGACGGTAACCGGGACCCGGTGTCT
RBdS156D18 pGCAP10 GGGTGAGGGGATGGAGGAAGGCGAGTTTTCAGAGGCCCGTGAAGATATGGCTGCCCTTGA
RBdS156G08 pGCAP10 GAGTGCGTTACTTACCTCGACTCTTAGCTTGTCGGGGACGGTAACCGGGACCCGGTGTCT
RBdS156G24 pGCAP10 GAGTGCGTTACTTACCTCNACTCTTAGCTTGNCGGGGACGGNAACCGGGACCCGGTGTCT
RBdS177A07 pGCAP10 GAGTGCGTTACTTACCTCGACTCTTAGCTTGTCGGGGACGGTAACCGGGACCCGGTGTCT
RBdS177P10 pGCAP10 GAGTGCGTTACTTACCTCGACTCTTAGCTTGTCGGGGACGGTAACCGGGACCCGGTGTCT
RBdS187A10 pGCAP10 GAGTGCGTTACTTACCTCGACTCTTAGCTTGTCGGGGACGGTAACCGGGACCCGGTGTCT
RBdS187J13 pGCAP10 ACCCAGCACCCCAGGTTTCCACAGCTGTAGTTGAGCCCTACAACTCCATCCTCACCACCC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl