Prev. | Human A to Z list > T > 

RIKEN DNA Bank Human Resource - TUBA1B

Gene ID (NCBI) 10376
Gene Symbol TUBA1B
Protein Name tubulin alpha 1b
Synonyms K-ALPHA-1
Databases KEGG hsa:10376 |  NCBI Gene 10376
Featured content Ortholog resources in the DNA Bank (KEGG orthology K07374)


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB12753 pFBD-Hs alpha1CGH/beta3CGF Plasmid clone for baculoviral expression of alpha1 and beta3 tubulin
RDB12754 pFBD-Hs alpha1(K40R)CGH/beta3CGF Plasmid clone for baculoviral expression of alpha1 and beta3 tubulin
RDB14530 pFBD-Hs alpha1 CFXaGH/beta3 CFXaGF Expression vector of His tagged human tubulin alpha-1and Flag tagged human tubulin beta-3.
RDB14531 pFBD-Hs alpha1(K40R) CFXaGH/beta3 CFXaGF Expression vector of His tagged human tubulin alpha-1(mutant, K40R, constitutive active form) and Flag tagged human tubulin beta-3.

RDB_org_170226.csv


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX005456 IRAK013K16 pCMV-SPORT6 BC008659 NM_006082 Full
HGX006144 IRAK015F24 pCMV-SPORT6 BC015883 NM_006082 Full
HGX007797 IRAK019I05 pCMV-SPORT6 BC010494 NM_006082 Full
HGX011119 IRAK027N07 pCMV-SPORT6 BC017004 NM_006082 Full
HGY081201 IRAL003A01 pOTB7 BC001128 NM_006082 Full
HGY082326 IRAL005N14 pOTB7 BC000696 NM_006082 Full
HGY083624 IRAL009A24 pOTB7 BC006481 NM_006082 Full
HGY084100 IRAL010E04 pOTB7 BC001128 NM_006082 Full
HGY084464 IRAL011C16 pOTB7 BC009513 NM_006082 Full
HGY084539 IRAL011F19 pOTB7 BC009509 NM_006082 Full
HGY084654 IRAL011K14 pOTB7 BC009512 NM_006082 Full
HGY086825 IRAL017B01 pOTB7 BC006379 NM_006082 Full
HGY090454 IRAL026C06 pOTB7 BC009314 NM_006082 Full
HGY091717 IRAL029E21 pOTB7 BC011572 NM_006082 Full
HGY094227 IRAL035J11 pDNR-LIB BC030820 NM_006082 Full
HGY096114 IRAL040E18 pOTB7 BC021564 NM_006082 Full/var
HGY103408 IRAL058I16 pOTB7 BC071904 NM_006082 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR041255 ARe03C07 pKA1U5 NM_006082.2  
GAGTGCGTTACTTACCTCGACTCTTAGCTTGTCGGGGACGGTAACCGGGACCCGGTGTCT
HKR161371 ARi03H03 pGCAP10 NM_006082.2  
GGCGTTACTTACCTCGACTCTTAGCTTGTCGGGGACGGTAACCGGGACCCGGTGTCTGCT
HKR045675 ARe14D03 pKA1U5 NM_006082.2  
GAGTGCGTTACTTACCTCGACTCTTAGCTTGTCGGGGACGGTAACCGGGACCCGGTGTCT
HKR169731 ARi24F11 pGCAP10 NM_006082.2  
TTGGTGAGTGCGTTACTTACCTCGACTCTTAGCTTGTCGGGGACGGTAACCGGGACCCGG
HKR054980 ARe37H12 pKA1U5 NM_006082.2  
GAGTGCGTTACTTACCTCGACTCTTAGCTTGTCGGGGACGGTAACCGGGACCCGGTGTCT
HKR055297 ARe38E01 pKA1U5 NM_006082.2  
GCTAGTGCGTTACTTACCTCGACTCTTAGCTTGTCGGGGACGGTAACCGGGACCCGGTGT
HKR173284 ARi33D12 pGCAP10 NM_006082.2  
GAGTGCGTTACTTACCTCGACTCTTAGCTTGTCGGGGACGGTAACCGGGACCCGGTGTCT
HKR175325 ARi38F05 pGCAP10 NM_006082.2  
GCTAGTGCGTTACTTACCTCGACTCTTAGCTTGTCGGGGACGGTAACCGGGACCCGGTGT
HKR057678 ARe44D06 pKA1U5 NM_006082.2  
GAGTGCGTTACTTACCTCGACTCTTAGCTTGTCGGGGACGGTAACCGGGACCCGGTGTCT
HKR057700 ARe44E04 pKA1U5 NM_006082.2  
GAGTGCGTTACTTACCTCGACTCTTAGCTTGTCNGGNTACGGTAACCGGGACCCGGTGTC
HKR059729 ARe49F09 pKA1U5 NM_006082.2  
GAGTGCGTTACTTACCTCGACTCTTAGCTTGTCGGGGACGGTAACCGGGACCCGGTGTCT
HKR176432 ARi41B08 pGCAP10 NM_006082.2  
GAGTGCGTTACTTACCTCGACTCTTAGCTTGTCGGGGACGGTAACCGGGACCCGGTGTCT
HKR179675 ARi49D03 pGCAP10 NM_006082.2  
GAGTGCGTTACTTACCTCGACTCTTAGCTTGTCGGGGACGGTAACCGGGACCCGGTGTCT
HKR065777 ARe64H09 pKA1U5 NM_006082.2  
GCTAGTGCGTTACTTACCTCGACTCTTTAGCTTGCTCGGGGACGGTAACCGGGACCCGGN
HKR066454 ARe66C06 pKA1U5 NM_006082.2  
GAGTGCGTTTACTTACCTCGACTCTTAGCTTGTCGGGGACGGTAACCGGGACCCGGTGTC
HKR184456 ARi61C08 pGCAP10 NM_006082.2  
GAGTGCGTTACTTACCTCGACTCTTAGCTTGTCGGGGACGGTAACCGGGACCCGGTGTCT
HKR186131 ARi65F11 pGCAP10 NM_006082.2  
GAGTGCGTTACTTACCTCGACTCTTAGCTTGTCGGGGACGGTAACCGGGACCCGGTGTCT
HKR187231 ARi68B07 pGCAP10 NM_006082.2  
GAGTGCGTTACTTACCTCGACTCTTAGCTTGTCGGGGACGGTAACCGGGACCCGGTGTCT
HKR187649 ARi69C01 pGCAP10 NM_006082.2  
GAGTGCGTTACTTACCTCGACTCTTAGCTTGTCGGGGACGGTAACCGGGACCCGGTGTCT
HKR070121 ARe75F01 pKA1U5 NM_006082.2  
GCTAGATGCGTTACTTACCTCGACTCTTAGCTTGCTCGGGGACGGTAACCGGGACCCGGN
HKR071732 ARe79F12 pKA1U5 NM_006082.2  
ATCCTGAGTGCGTTACTTACCTCGACTCTTAGCTTGTCGGGGACGGTAACCGGGACCCGG
HKR218140 ARiS045F20 pGCAP10 NM_006082.2  
GAGTGCGTTACTTACCTCGACTCTTAGCTTGTCGGGGACGGTAACCGGGACCCGGTGTCT
HKR218219 ARiS045J03 pGCAP10 NM_006082.2  
TGAGTGCGTTACTTACCTCGACTCTTAGCTTGTCGGGGACGGTAACCGGGACCCGGTGTC
HKR218275 ARiS045L11 pGCAP10 NM_006082.2  
HKR234245 ARiS085K05 pGCAP10 NM_006082.2  
GAGTGCGTTACTTACCTCGACTCTTAGCTTGTCGGGGACGGTAACCGGGACCCGGTGTCT
HKR234911 ARiS087E15 pGCAP10 NM_006082.2  
GCTAGTGCGTTACTTACCTCGACTCTTAGCTTGTCGGGGACGGTAACCGGGACCCGGTGT
HKR235319 ARiS088E23 pGCAP10 NM_006082.2  
GAGTGCGTTACTTACCTCGACTCTTAGCTTGTCGGGGACGGTAACCGGGACCCGGTGTCT
HKR243626 ARiS109B02 pGCAP10 NM_006082.2  
TGAGTGCGTTACTTACCTCGACTCTTAGCTTGTCGGGGACGGTAACCGGGACCCGGTGTC
HKR243766 ARiS109G22 pGCAP10 NM_006082.2  
TGAGTGCGTTACTTACCTCGACTCTTAGCTTGTCGGGGACGGTAACCGGGACCCGGTGTC
HKR249027 ARiS122J11 pGCAP10 NM_006082.2  
GAGTGCGTTACTTACCTCGACTCTTAGCTTGTCGGGGACGGTAACCGGGACCCGGTGTCT
HKR276640 ARiS191J24 pGCAP10 NM_006082.2  
GAGTGCGTTACTTACCTCGACTCTTAGCTTGTCGGGGACGGTAACCGGGACCCGGTGTCT
HKR276650 ARiS191K10 pGCAP10 NM_006082.2  
GCTAGTGCGTTACTTACCTCGACTCTTAGCTTGTCGGGGACGGTAACCGGGACCCGGTGT
HKR321699 RBb04E03 pKA1U5 NM_006082.2  
AGTGCGTTACTTACCTCGACTCTTAGCTTGTCGGGGACGGTAACCGGGACCCGGTGTCTG
HKR360854 RBd02C06 pGCAP10 NM_006082.2  
GAGTGCGTTACTTACCTCGACTCTTAGCTTGTCGGGGACGGTAACCGGGACCCGGTGTCT
HKR361227 RBd03B03 pGCAP10 NM_006082.2  
TGAGTGCGTTACTTACCTCGACTCTTAGCTTGTCGGGGACGGTAACCGGGACCCGGTGTC
HKR361349 RBd03G05 pGCAP10 NM_006082.2  
GGCAGGTTCTCTTACATCGACCGCCTAAGAGTCGCGCTGTAAGAAGCAACAACCTCTCCT
HKR362132 RBd05F12 pGCAP10 NM_006082.2  
GAGTGCGTTACTTACCTCGACTCTTAGCTTGTCGGGGACGGTAACCGGGACCCGGTGTCT
HKR362877 RBd07D05 pGCAP10 NM_006082.2  
GGCAGGTTCTCTTACATCGACCGCCTAAGAGTCGCGCTGTAAGAAGCAACAACCTCTCCT
HKR362908 RBd07E12 pGCAP10 NM_006082.2  
GGCCTAAGAGTCGCGCTGTAAGAAGCAACAACCTCTCCTCTTCGTCTCCGCCATCAGCTC
HKR363321 RBd08F01 pGCAP10 NM_006082.2  
GGCAGGTTCTCTTACATCGACCGCCTAAGAGTCGCGCTGTAAGAAGCAACAACCTCTCCT
HKR326059 RBb15C11 pKA1U5 NM_006082.2  
GAGTGCGTTACTTACCTCGACTCTTAGCTTGTCGGGGACGGTAACCGGGACCCGGTGTCT
HKR326580 RBb16H12 pKA1U5 NM_006082.2  
GAGTGCGTTACTTACCTCGACTCTTAGCTTGTCGGGGACGGTAACCGGGACCCGGTGTCT
HKR367206 RBd18A06 pGCAP10 NM_006082.2  
GGCAGGTTCTCTTACATCGACCGCCTAAGAGTCGCGCTGTAAGAAGCAACAACCTCTCCT
HKR328152 RBb20G08 pKA1U5 NM_006082.2  
GCTAGTGCGTTACTTACCTCGACTCTTAGCTTGTCGGGGACGGTAACCGGGACCCGGTGT
HKR329775 RBb24H07 pGCAP1 NM_006082.2  
TGGCTAGTGCGTTTACTTACCTCGACTCTTAGCTTGTCGGGGACGGTAACCGGGACCCGG
HKR372980 RBd32H12 pGCAP10 NM_006082.2  
GAGTGCGTTACTTACCTCGACTCTTAGCTTGTCGGGGACGGTAACCGGGACCCGGTGTCT
HKR339304 RBb48E08 pGCAP1 NM_006082.2  
AGTGCGTTACTTACCTCGCACTCTTAGCTTGTCGGGGACGGTAACCGGGACCCGGTGTCT
HKR376502 RBd41E06 pGCAP10 NM_006082.2  
GAGTGCGTTACTTACCTCGACTCTTAGCTTGTCGGGGACGGTAACCGGGACCCGGTGTCT
HKR379674 RBd49D02 pGCAP10 NM_006082.2  
GGCAGGTTCTCTTACATCGACCGCCTAAGAGTCGCGCTGTAAGAAGCAACAACCTCTCCT
HKR343346 RBb58G02 pGCAP1 NM_006082.2  
GAGTGCGTTACTTACCTCGACTCTTAGCTTGTCGGGGACGGTAACCGGGACCCGGTGTCT
HKR380083 RBd50D11 pGCAP10 NM_006082.2  
GCTAGTGCGTTACTTACCTCGACTCTTAGCTTGTCGGGGACGGTAACCGGGACCCGGTGT
HKR380830 RBd52B06 pGCAP10 NM_006082.2  
GAGTGCGTTACTTACCTCGACTCTTAGCTTGTCGGGGACGGTAACCGGGACCCGGTGTCT
HKR382858 RBd57C10 pGCAP10 NM_006082.2  
GGTTACTTACCTCGACTCTTAGCTTGTCGGGGACGGTAACCGNNNNCCGGTGTCTGCTCC
HKR383724 RBd59F04 pGCAP10 NM_006082.2  
GGCAGGTTCTCTTACATCGACCGCCTAAGAGTCGCGCTGTAAGAAGCAACAACCTCTCCT
HKR385698 RBd64E02 pGCAP10 NM_006082.2  
GAGTGCGTTACTTACCTCGACTCTTAGCTTGTCGGGGACGGTAACCGGGACCCGGTGTCT
HKR385750 RBd64G06 pGCAP10 NM_006082.2  
GAGTGCGTTACTTACCTCGACTCTTAGCTTGTCGGGGACGGTAACCGGGACCCGGTGTCT
HKR386569 RBd66H01 pGCAP10 NM_006082.2  
GAGTGNGTTACTTACCTCGACTCTTAGCTTGTCGGGGACGGTAACCGGGACCCGGTGTCT
HKR388549 RBd71G05 pGCAP10 NM_006082.2  
GGCAGGTTCTCTTACATCGACCGCCTAAGAGTCGCGCTGTAAGAAGCAACAACCTCTCCT
HKR388579 RBd71H11 pGCAP10 NM_006082.2  
GAGTGCGTTACTTACCTCGACTCTTAGCTTGTCGGGGACGGTAACCGGGACCCGGTGTCT
HKR390545 RBd76G01 pGCAP10 NM_006082.2  
GAGTGCGTTACTTACCTCGACTCTTAGCTTGTCGGGGACGGTAACCGGGACCCGGTGTCT
HKR391234 RBd78B10 pGCAP10 NM_006082.2  
GGCAGGTTCTCTTACATCGACCGCCTAAGAGTCGCGCTGTAAGAAGCAACAACCTCTCCT
HKR393279 RBd83D07 pGCAP10 NM_006082.2  
TGGAGTGCGTTACTTACCTCGACTCTTAGCTTGTCGGGGACGGTAACCGGGACCCGGTGT
HKR394004 RBd85A04 pGCAP10 NM_006082.2  
AGGAGTGCGTTACTTACCTCGACTCTTAGCTTGTCGGGGACGGTAACCGGGACCCGGTGT
HKR395702 RBd89E06 pGCAP10 NM_006082.2  
GAGGGTTCTCTTACATCGACCGCCTAAGAGTCGCGCTGTAAGAAGCAACAACCTCTCCTC
HKR396460 RBd91C12 pGCAP10 NM_006082.2  
GAGTGCGTTACTTACCTCGACTCTTAGCTTGTCGGGGACGGTAACCGGGACCCGGTGTCT
HKR396477 RBd91D05 pGCAP10 NM_006082.2  
GACTTACCTCGACTCTTAGCTTGTCGGGGACGGTAACCGGGACCCGGTGTCTGCTCCTGT
HKR397749 RBd94G05 pGCAP10 NM_006082.2  
GGCAGGTTCTCTTACATCGACCGCCTAAGAGTCGCGCTGTAAGAAGCAACAACCTCTCCT
HKR405515 RBdS013N03 pGCAP10 NM_006082.2  
GGCAGGTTCTCTTACATCGACCGCCTAAGAGTCGCGCTGTAAGAAGCAACAACCTCTCCT
HKR405618 RBdS014A18 pGCAP10 NM_006082.2  
CGGCCGGCCGATGGCAGGTTCTCTTACATCGACCGCCTAAGAGTCGCGCTGTAAGAAGCA
HKR406020 RBdS015A20 pGCAP10 NM_006082.2  
GAGTGCGTTACTTACCTCGACTCTTAGCTTGTCGGGGACGGTAACCGGGACCCGGTGTCT
HKR416106 RBdS040E10 pGCAP10 NM_006082.2  
GAGTGCGTTACTTACCTCGACTCTTAGCTTGTCGGGGACGGTAACCGGGACCCGGTGTCT
HKR420480 RBdS051D08 pGCAP10 NM_006082.2  
GAGTGCGTTACTTACCTCGACTCTTAGCTTGTCGGGGACGGTAACCGGGACCCGGTGTCT
HKR428307 RBdS070M19 pGCAP10 NM_006082.2  
GAGTGCGTTACTTACCTCGACTCTTAGCTTGTCGGGGACGGTAACCGGGACCCGGTGTCT
HKR430036 RBdS075B12 pGCAP10 NM_006082.2  
GAGTGCGTTACTTACCTCGACTCTTAGCTTGTCGGGGACGGTAACCGGGACCCGGTGTCT
HKR430062 RBdS075C14 pGCAP10 NM_006082.2  
GAGTGCGTTACTTACCTCGACTCTTAGCTTGTCGGGGACGGTAACCGGGACCCGGTGTCT
HKR432571 RBdS081H03 pGCAP10 NM_006082.2  
GAGGTTCTCTTACATCGACCGCCTAAGAGTCGCGCTGTAAGAAGCAACAACCTCTCCTCT
HKR432644 RBdS081K04 pGCAP10 NM_006082.2  
GAGTGCGTTACTTACCTCGACTCTTAGCTTGTCGGGGACGGTAACCGGGACCCGGTGTCT
HKR433557 RBdS083O21 pGCAP10 NM_006082.2  
GGCAGGTTCTCTTACATCGACCGCCTAAGAGTCGCGCTGTAAGAAGCAACAACCTCTCCT
HKR433583 RBdS083P23 pGCAP10 NM_006082.2  
GAGTGCGTTACTTACCTCGACTCTTAGCTTGTCGGGGACGGTAACCGGGACCCGGTGTCT
HKR441635 RBdS104B11 pGCAP10 NM_006082.2  
GCTAGTGCGTTACTTACCTCGACTCTTAGCTTGTCGGGGACGGTAACCGGGACCCGGTGT
HKR441723 RBdS104F03 pGCAP10 NM_006082.2  
GAGTGCGTTACTTACCTCGACTCTTAGCTTGTCGGGGACGGTAACCGGGACCCGGTGTCT
HKR441877 RBdS104L13 pGCAP10 NM_006082.2  
GAGTGCGTTACTTACCTCGACTCTTAGCTTGTCGGGGACGGTAACCGGGACCCGGTGTCT
HKR442092 RBdS105D20 pGCAP10 NM_006082.2  
GGCAGGTTCTCTTACATCGACCGCCTAAGAGTCGCGCTGTAAGAAGCAACAACCTCTCCT
HKR444371 RBdS110P11 pGCAP10 NM_006082.2  
GAGTGCGTTACTTACCTCGACTCTTAGCTTGTCGGGGACGGTAACCGGGACCCGGTGTCT
HKR461796 RBdS154I04 pGCAP10 NM_006082.2  
GAGTGCGTTACTTACCTCGACTCTTAGCTTGTCGGGGACGGTAACCGGGACCCGGTGTCT
HKR462490 RBdS156D18 pGCAP10 NM_006082.2  
GGGTGAGGGGATGGAGGAAGGCGAGTTTTCAGAGGCCCGTGAAGATATGGCTGCCCTTGA
HKR462552 RBdS156G08 pGCAP10 NM_006082.2  
GAGTGCGTTACTTACCTCGACTCTTAGCTTGTCGGGGACGGTAACCGGGACCCGGTGTCT
HKR462568 RBdS156G24 pGCAP10 NM_006082.2  
GAGTGCGTTACTTACCTCNACTCTTAGCTTGNCGGGGACGGNAACCGGGACCCGGTGTCT
HKR470807 RBdS177A07 pGCAP10 NM_006082.2  
GAGTGCGTTACTTACCTCGACTCTTAGCTTGTCGGGGACGGTAACCGGGACCCGGTGTCT
HKR471170 RBdS177P10 pGCAP10 NM_006082.2  
GAGTGCGTTACTTACCTCGACTCTTAGCTTGTCGGGGACGGTAACCGGGACCCGGTGTCT
HKR474810 RBdS187A10 pGCAP10 NM_006082.2  
GAGTGCGTTACTTACCTCGACTCTTAGCTTGTCGGGGACGGTAACCGGGACCCGGTGTCT
HKR475029 RBdS187J13 pGCAP10 NM_006082.2  
ACCCAGCACCCCAGGTTTCCACAGCTGTAGTTGAGCCCTACAACTCCATCCTCACCACCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2018.03.01

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180123.pl