Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00220

HP ID(1) HP00220
Gene ID(2) 84790
Gene Symbol finder TUBA1C
Protein Name tubulin, alpha 1c
RefSeq NM_032704.3
Length of RefSeq (bp) 1581
Chromosome 12q12-q14
Reference DDBJ accession
UniGene Hs.719091

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe82B09 pKA1U5 GACTACTTCTCCCCCGGACTCCTTGGTAGTCTGTTAGTGGGAGATCCTTGTTGCCGTCCC
ARi06D03 pGCAP10 GACTACTTCTCCCCCGGACTCCTTGGTAGTCTGTTAGTGGGAGATCCTTGTTGCCGTCCC
ARi09A10 pGCAP10 GACTACTTCTCCCCCGGACTCCTTGGTAGTCTGTTAGTGGGAGATCCTTGTTGCCGTCCC
ARi11G12 pGCAP10 TGACTACTTCTCCCCCGGACTCCTTGGTAGTCTGTTAGTGGGAGATCCTTGTTGCCGTCC
ARi26A05 pGCAP10 ACTACTTCTCCCCCGGACTCCTTGGTAGTCTGTTAGTGGGAGATCCTTGTTGCCGTCCCT
ARi39D05 pGCAP10 GACTACTTCTCCCCCGGACTCCTTGGTAGTCTGTTAGTGGGAGATCCTTGTTGCCGTCCC
ARi49H09 pGCAP10 ACTACTTCTCCCCCGGACTCCTTGGTAGTCTGTTAGTGGGAGATCCTTGTTGCCGTCCCT
ARi58F04 pGCAP10 GTTCACTACTTCTCCCCCGGACTCCTTGGTAGTCTGTTAGTGGGAGATCCTTGTTGCCGT
ARiS008F24 pGCAP10 GACTACTTCTCCCCCGGACTCCTTGGTAGTCTGTTAGTGGGAGATCCTTGTTGCCGTCCC
ARiS023N20 pGCAP10 CGGCCGGCCGATACTACTTCTCCCCCGGACTCCTTGGTAGTCTGTTAGTGGGAGATCCTT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl