Prev. |  KEGG KO K07374 > 

RIKEN DNA Bank Human Resource - TUBA1C

Gene ID NCBI Gene 84790 |  KEGG hsa:84790
Gene Symbol TUBA1C
Protein Name tubulin alpha 1c
Synonyms TUBA6|bcm948
Featured content Apoptosis - human
Ortholog resource in our bank

  TUBA1C

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX047624 IRAK119A24 pCMV-SPORT6 BC063036 NM_032704 Full
HGY083314 IRAL008E18 pOTB7 BC021088 NM_032704 Full
HGY083908 IRAL009M20 pOTB7 BC019298 NM_032704 Full
HGY085569 IRAL013P09 pOTB7 BC004949 NM_032704 Full
HGY088637 IRAL021J21 pDNR-LIB BC005946 NM_032704 Full
HGY091084 IRAL027L20 pOTB7 BC011790 NM_032704 Full
HGY097259 IRAL043C11 pOTB7 BC033064 NM_032704 Full/var
HGY098824 IRAL047A24 pOTB7 BC051297 NM_032704 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE096440 M01C041B16 pDONR221 MGC10-D08 BC005946 ENST00000301072  
HGE096488 M01C041D16 pDONR221 MGC10-D08 BC005946 ENST00000301072  
HGE096536 M01C041F16 pDONR221 MGC10-D08 BC005946 ENST00000301072  
HGE096584 M01C041H16 pDONR221 MGC10-D08 BC005946 ENST00000301072  
HGE096632 M01C041J16 pDONR221 MGC10-D08 BC005946 ENST00000301072  
HGE096680 M01C041L16 pDONR221 MGC10-D08 BC005946 ENST00000301072  
HGE096728 M01C041N16 pDONR221 MGC10-D08 BC005946 ENST00000301072  
HGE096776 M01C041P16 pDONR221 MGC10-D08 BC005946 ENST00000301072  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR072833 ARe82B09 pKA1U5 NM_032704.3  
GACTACTTCTCCCCCGGACTCCTTGGTAGTCTGTTAGTGGGAGATCCTTGTTGCCGTCCC
HKR162475 ARi06D03 pGCAP10 NM_032704.3  
GACTACTTCTCCCCCGGACTCCTTGGTAGTCTGTTAGTGGGAGATCCTTGTTGCCGTCCC
HKR163610 ARi09A10 pGCAP10 NM_032704.3  
GACTACTTCTCCCCCGGACTCCTTGGTAGTCTGTTAGTGGGAGATCCTTGTTGCCGTCCC
HKR164556 ARi11G12 pGCAP10 NM_032704.3  
TGACTACTTCTCCCCCGGACTCCTTGGTAGTCTGTTAGTGGGAGATCCTTGTTGCCGTCC
HKR170405 ARi26A05 pGCAP10 NM_032704.3  
ACTACTTCTCCCCCGGACTCCTTGGTAGTCTGTTAGTGGGAGATCCTTGTTGCCGTCCCT
HKR175677 ARi39D05 pGCAP10 NM_032704.3  
GACTACTTCTCCCCCGGACTCCTTGGTAGTCTGTTAGTGGGAGATCCTTGTTGCCGTCCC
HKR179777 ARi49H09 pGCAP10 NM_032704.3  
ACTACTTCTCCCCCGGACTCCTTGGTAGTCTGTTAGTGGGAGATCCTTGTTGCCGTCCCT
HKR183324 ARi58F04 pGCAP10 NM_032704.3  
GTTCACTACTTCTCCCCCGGACTCCTTGGTAGTCTGTTAGTGGGAGATCCTTGTTGCCGT
HKR203344 ARiS008F24 pGCAP10 NM_032704.3  
GACTACTTCTCCCCCGGACTCCTTGGTAGTCTGTTAGTGGGAGATCCTTGTTGCCGTCCC
HKR209532 ARiS023N20 pGCAP10 NM_032704.3  
CGGCCGGCCGATACTACTTCTCCCCCGGACTCCTTGGTAGTCTGTTAGTGGGAGATCCTT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


No Approval Forms Required for Fluorescent Protein Genes Developed by Dr. Atsushi Miyawaki
♦ RIKEN BRC will be closed from December 28, 2024 through January 5, 2025 due to New Year's holidays.
A bicistronic cell cycle reporter, Fucci2a (Sep 17, 2024)
Monomeric Fluorescent Protein Resource, mStayGold (Dec 18, 2023)
Visualization of Organelles update (Dec 18, 2023)
Development of two mouse strains conditionally expressing bright luciferases (Sep 08, 2023)
Autophagy and Mitophagy Updates (Aug 16, 2023)
High intensity forms of luciferase and luminescent proteins from various organisms (BRC RESOURCE NEWS) (Apr 28, 2023)
Plasmid of Cas9 expression/mRNA production, evaluation of the genome edit efficiency, and Knock-in donors and tags
Fucci cell cycle indicator, Calcium sensor and Fluorescent and Luminescent protein resources
Revision of Distribution Fees for Bioresources in RIKEN BRC
- - - - - - - - - - - - - - - - - - - -
Mail News sign-up. Receive information of the forcusd resources, new available resources and more.
♦ Please visit "Terms of Use", "Quality control" and "Ordering instruction"
Dnaconda's recommendation BRC Resource News RIKEN BRC 20th RIKEN BRC News sign-up

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl