Prev. | NRCD Clone B | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00217

HP ID(1) HP00217
Gene ID(2) 7917
Gene Symbol finder BAT3
Protein Name HLA-B associated transcript 3
RefSeq NM_004639.3
Length of RefSeq (bp) 3832
Chromosome 6p21.3
Reference DDBJ accession
UniGene Hs.440900

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS096G13 pGCAP10 CGGCCGGCCGATGGCACGCAGGCGTAGTACGGTCCCCCGGGCGACAGCGGTGGCGGCTCC
ARiS096M19 pGCAP10 GGTAGTACNGTCCCCCGGGCGACAGCGGTGGCGGCTCCTCGGGGTGCTCGGCTCCCTCCC
RBb11A07 pKA1U5 GAGGCGTAGTACGGTCCCCCGGGCGACAGCGGTGGCGGCTCCTCGGGGTGCTCGGCTCCC
RBd24G09 pGCAP10 GGGGCGGAGCCGCGGGGTGGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTG
RBd72B03 pGCAP10 GGGGCGGAGCCGCGGGGTGGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTAAGCCTG
RBd78D07 pGCAP10 GACGGTCCCCCGGGCGACAGCGGTGGCGGCTCCTCGGGGTGCTCGGCTCCCTCCCACCTA
RBdS081E11 pGCAP10 GGGGGAAGTCGGGGGCGGANCCGCGGGGTGGTGGGTGGNTGNNTGTGTNNGNGTGTAANA
RBdS154G05 pGCAP10 GACGGTCCCCCGGGCGACAGCGGTGGCGGCTCCTCGGGGTGCTCGGCTCCCTCCCACCTA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl