Prev. | 

RIKEN DNA Bank Human Resource - BAG6

Gene ID NCBI Gene 7917 |  KEGG hsa:7917
Gene Symbol BAG6
Protein Name BCL2 associated athanogene 6
Synonyms BAG-6|BAT3|D6S52E|G3
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY083970 IRAL009P10 pOTB7 BC003133 NM_080703 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR238557 ARiS096G13 pGCAP10 NM_004639.3  
CGGCCGGCCGATGGCACGCAGGCGTAGTACGGTCCCCCGGGCGACAGCGGTGGCGGCTCC
HKR238707 ARiS096M19 pGCAP10 NM_004639.3  
GGTAGTACNGTCCCCCGGGCGACAGCGGTGGCGGCTCCTCGGGGTGCTCGGCTCCCTCCC
HKR324407 RBb11A07 pKA1U5 NM_004639.3  
GAGGCGTAGTACGGTCCCCCGGGCGACAGCGGTGGCGGCTCCTCGGGGTGCTCGGCTCCC
HKR369753 RBd24G09 pGCAP10 NM_004639.3  
GGGGCGGAGCCGCGGGGTGGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTG
HKR388827 RBd72B03 pGCAP10 NM_004639.3  
GGGGCGGAGCCGCGGGGTGGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTAAGCCTG
HKR391279 RBd78D07 pGCAP10 NM_004639.3  
GACGGTCCCCCGGGCGACAGCGGTGGCGGCTCCTCGGGGTGCTCGGCTCCCTCCCACCTA
HKR432507 RBdS081E11 pGCAP10 NM_004639.3  
GGGGGAAGTCGGGGGCGGANCCGCGGGGTGGTGGGTGGNTGNNTGTGTNNGNGTGTAANA
HKR461749 RBdS154G05 pGCAP10 NM_004639.3  
GACGGTCCCCCGGGCGACAGCGGTGGCGGCTCCTCGGGGTGCTCGGCTCCCTCCCACCTA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.17

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_190501.pl