Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00210

HP ID(1) HP00210
Gene ID(2) 8407
Gene Symbol finder TAGLN2
Protein Name transgelin 2
RefSeq NM_003564.1
Length of RefSeq (bp) 1360
Chromosome 1q21-q25
Reference DDBJ accession
UniGene Hs.517168

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe06B12 pKA1U5 GACTTGCAGCTGCAGCCCTTGCCTTGAGTCAGTGCGCCGCTCTCCAGCCCGCTTGAACGC
ARe09D01 pKA1U5 CACTTCCAGACTNCAGACCCTTTGACCNTTGTAGTCANTGCGCCNACTCTTCCANTCCCG
ARe15G04 pKA1U5 GGCAGCTGCAGCCCTTGCCTTGAGTCAGTGCGCCGCTCTCCAGCCCGCTTGAACGCTCCC
ARe24C09 pKA1U5 GCCCCGGCTGGGCAGGGCGCACCACTTGCAGCTGCAGCCCTTGCCTTGAGTCAGTGCGCC
ARe29E05 pKA1U5 GGAGGCGGGACCCTCCTGAAAATCCCCGGCTGGGCAGGGCGCACCACTTGCAGCTGCAGC
ARe32A07 pKA1U5 TGACTTGCAGCTGCAGCCCTTGCCTTGAGTCAGTGCGCCGCTCTCCAGCCCGCTTGAACG
ARe42D01 pKA1U5 GGCACCACTTGCAGCTGCAGCCCTTGCCTTGAGTCAGTGCGCCGCTCTCCAGCCCGCTTG
ARe54E12 pKA1U5 GAGTGCGCCGCTCTCCAGCCCGCTTGAACGCTCCCCGCAGCCACCGCCACCCATTGGAAT
ARe83F09 pKA1U5 GACTTGCAGCTGCAGCCCTTGCCTTGAGTCAGTGCGCCGCTCTCCAGCCCGCTTGAACGC
ARe91A08 pKA1U5 GACTTGCAGCTGCAGCCCTTGCCTTGAGTCAGTGCGCCGCTCTCCAGCCCGCTTGAACGC
ARe94H05 pKA1U5 GACTTGCAGCTGCAGCCCTTGCCTTGAGTCAGTGCGCCGCTCTCCAGCCCGCTTGAACGC
ARe99H08 pKA1U5 GTGGGAGGCCGGACCTGCAGGACCGGAGGTGGACTGCCGCCTCCCCCCGCGCCCTGTGCC
ARf04E10 pKA1U5 ATCCTGGACTTGCAGCTGCAGCCCTTGCCTTGAGTCAGTGCGCCGCTCTCCAGCCCGCTT
ARi12E09 pGCAP10 GACTTGCAGCTGCAGCCCTTGCCTTGAGTCAGTGCGCCGCTCTCCAGCCCGCTTGAACGC
ARi28F03 pGCAP10 GACTTGCAGCTGCAGCCCTTGCCTTGAGTCAGTGCGCCGCTCTCCAGCCCGCTTGAACGC
ARi46B04 pGCAP10 GACTTGCAGCTGCAGCCCTTGCCTTGAGTCAGTGCGCCGCTCTCCAGCCCGCTTGAACGC
ARi56C05 pGCAP10 GAGTGCGCCGCTCTCCAGCCCGCTTGAACGCTCCCCGCAGCCACCGCCACCCATTGGAAT
ARi57G10 pGCAP10 GACTTGCAGCTGCAGCCCTTGCCTTGAGTCAGTGCGCCGCTCTCCAGCCCGCTTGAACGC
ARiS049B21 pGCAP10 GACTTGCAGCTGCAGCCCTTGCCTTGAGTCAGTGCGCCGCTCTCCAGCCCGCTTGAACGC
ARiS049C02 pGCAP10 GGAGTCAGTGCGCCGCTCTCCAGCCCGCTTGAACGCTCCCCGCAGCCACCGCCACCCATT
ARiS085L13 pGCAP10 GACTTGCAGCTGCAGCCCTTGCCTTGAGTCAGTGCGCCGCTCTCCAGCCCGCTTGAACGC
ARiS109J16 pGCAP10 ANTGCGCCGNTCTCCNGCCCGCTTGAACNCTCCCCGCANCCACCGCCACCCATTGGAATG
ARiS122C11 pGCAP10 GAGTGCNCCCCTCTCCACCCCCCTTGAACNCTCCCCNNNACCACCGCCACCCATTGGAAT
ARiS161M18 pGCAP10 GGCAGCTGCAGCCCTTGCCTTGAGTCAGTGCGCCGCTCTCCAGCCCGCTTGAACGCTCCC
ARiS194B21 pGCAP10 GGCACCACTTGCAGCTGCAGCCCTTGCCTTGAGTCAGTGCGCCGCTCTCCAGCCCGCTTG
RBdS104E15 pGCAP10 GACCACTTGCAGCTGCAGCCCTTGCCTTGAGTCAGTGCGCCGCTCTCCAGCCCGCTTGAA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl