Prev. |  KEGG KO K20526 > 

RIKEN DNA Bank Human Resource - TAGLN2

Gene ID NCBI Gene 8407 |  KEGG hsa:8407
Gene Symbol TAGLN2
Protein Name transgelin 2
Synonyms HA1756
Ortholog resource in our bank

  TAGLN2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY081970 IRAL004P10 pOTB7 BC002616 NM_003564 Full/var
HGY090742 IRAL026O06 pOTB7 BC009357 NM_003564 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR042436 ARe06B12 pKA1U5 NM_003564.1  
GACTTGCAGCTGCAGCCCTTGCCTTGAGTCAGTGCGCCGCTCTCCAGCCCGCTTGAACGC
HKR043673 ARe09D01 pKA1U5 NM_003564.1  
CACTTCCAGACTNCAGACCCTTTGACCNTTGTAGTCANTGCGCCNACTCTTCCANTCCCG
HKR046148 ARe15G04 pKA1U5 NM_003564.1  
GGCAGCTGCAGCCCTTGCCTTGAGTCAGTGCGCCGCTCTCCAGCCCGCTTGAACGCTCCC
HKR049657 ARe24C09 pKA1U5 NM_003564.1  
GCCCCGGCTGGGCAGGGCGCACCACTTGCAGCTGCAGCCCTTGCCTTGAGTCAGTGCGCC
HKR051701 ARe29E05 pKA1U5 NM_003564.1  
GGAGGCGGGACCCTCCTGAAAATCCCCGGCTGGGCAGGGCGCACCACTTGCAGCTGCAGC
HKR052807 ARe32A07 pKA1U5 NM_003564.1  
TGACTTGCAGCTGCAGCCCTTGCCTTGAGTCAGTGCGCCGCTCTCCAGCCCGCTTGAACG
HKR056873 ARe42D01 pKA1U5 NM_003564.1  
GGCACCACTTGCAGCTGCAGCCCTTGCCTTGAGTCAGTGCGCCGCTCTCCAGCCCGCTTG
HKR061708 ARe54E12 pKA1U5 NM_003564.1  
GAGTGCGCCGCTCTCCAGCCCGCTTGAACGCTCCCCGCAGCCACCGCCACCCATTGGAAT
HKR073329 ARe83F09 pKA1U5 NM_003564.1  
GACTTGCAGCTGCAGCCCTTGCCTTGAGTCAGTGCGCCGCTCTCCAGCCCGCTTGAACGC
HKR076408 ARe91A08 pKA1U5 NM_003564.1  
GACTTGCAGCTGCAGCCCTTGCCTTGAGTCAGTGCGCCGCTCTCCAGCCCGCTTGAACGC
HKR077773 ARe94H05 pKA1U5 NM_003564.1  
GACTTGCAGCTGCAGCCCTTGCCTTGAGTCAGTGCGCCGCTCTCCAGCCCGCTTGAACGC
HKR079776 ARe99H08 pKA1U5 NM_003564.1  
GTGGGAGGCCGGACCTGCAGGACCGGAGGTGGACTGCCGCCTCCCCCCGCGCCCTGTGCC
HKR081706 ARf04E10 pKA1U5 NM_003564.1  
ATCCTGGACTTGCAGCTGCAGCCCTTGCCTTGAGTCAGTGCGCCGCTCTCCAGCCCGCTT
HKR164905 ARi12E09 pGCAP10 NM_003564.1  
GACTTGCAGCTGCAGCCCTTGCCTTGAGTCAGTGCGCCGCTCTCCAGCCCGCTTGAACGC
HKR171323 ARi28F03 pGCAP10 NM_003564.1  
GACTTGCAGCTGCAGCCCTTGCCTTGAGTCAGTGCGCCGCTCTCCAGCCCGCTTGAACGC
HKR178428 ARi46B04 pGCAP10 NM_003564.1  
GACTTGCAGCTGCAGCCCTTGCCTTGAGTCAGTGCGCCGCTCTCCAGCCCGCTTGAACGC
HKR182453 ARi56C05 pGCAP10 NM_003564.1  
GAGTGCGCCGCTCTCCAGCCCGCTTGAACGCTCCCCGCAGCCACCGCCACCCATTGGAAT
HKR182954 ARi57G10 pGCAP10 NM_003564.1  
GACTTGCAGCTGCAGCCCTTGCCTTGAGTCAGTGCGCCGCTCTCCAGCCCGCTTGAACGC
HKR219645 ARiS049B21 pGCAP10 NM_003564.1  
GACTTGCAGCTGCAGCCCTTGCCTTGAGTCAGTGCGCCGCTCTCCAGCCCGCTTGAACGC
HKR219650 ARiS049C02 pGCAP10 NM_003564.1  
GGAGTCAGTGCGCCGCTCTCCAGCCCGCTTGAACGCTCCCCGCAGCCACCGCCACCCATT
HKR234277 ARiS085L13 pGCAP10 NM_003564.1  
GACTTGCAGCTGCAGCCCTTGCCTTGAGTCAGTGCGCCGCTCTCCAGCCCGCTTGAACGC
HKR243832 ARiS109J16 pGCAP10 NM_003564.1  
ANTGCGCCGNTCTCCNGCCCGCTTGAACNCTCCCCGCANCCACCGCCACCCATTGGAATG
HKR248859 ARiS122C11 pGCAP10 NM_003564.1  
GAGTGCNCCCCTCTCCACCCCCCTTGAACNCTCCCCNNNACCACCGCCACCCATTGGAAT
HKR264706 ARiS161M18 pGCAP10 NM_003564.1  
GGCAGCTGCAGCCCTTGCCTTGAGTCAGTGCGCCGCTCTCCAGCCCGCTTGAACGCTCCC
HKR277645 ARiS194B21 pGCAP10 NM_003564.1  
GGCACCACTTGCAGCTGCAGCCCTTGCCTTGAGTCAGTGCGCCGCTCTCCAGCCCGCTTG
HKR441711 RBdS104E15 pGCAP10 NM_003564.1  
GACCACTTGCAGCTGCAGCCCTTGCCTTGAGTCAGTGCGCCGCTCTCCAGCCCGCTTGAA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl