Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00196

HP ID(1) HP00196
Gene ID(2) 7114
Gene Symbol finder TMSB4X
Protein Name thymosin beta 4, X-linked
RefSeq NM_021109.3
Length of RefSeq (bp) 657
Chromosome Xq21.3-q22
Reference DDBJ accession
UniGene Hs.522584

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe02D08 pKA1U5 GGACAACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCGCT
ARe08B04 pKA1U5 GGACAACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCGCT
ARe15E01 pKA1U5 AACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCGCTTCGC
ARe22F05 pKA1U5 AACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCGCTTCGC
ARe26D12 pKA1U5 GGACAACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCGCT
ARe35F05 pKA1U5 GGACAACTCGGTGGTGGCCACTGCGCAGACCANCACTTCGCTCGTACTCGTGCGCCTCGC
ARe45B01 pKA1U5 GAACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCGCTTCG
ARe46D04 pKA1U5 ATCCTGAACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCG
ARe52A06 pKA1U5 TGGTGAACTCGGTGGTGGCCACTGCGCAGACCACCACTTCGCTCGTACTCGTGCGCCTCG
ARe53H09 pKA1U5 ATCCTGAACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCG
ARe58C05 pKA1U5 TGAACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCGCTTC
ARe58E10 pKA1U5 GGACAACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCGCT
ARe59F10 pKA1U5 ATCCTGAACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCG
ARe61F05 pKA1U5 GGACAACTCGGTGGTGGCCACTGCGCAGACCANCCTTCGCTCGTACTCGTGCGCCTCGCT
ARe61G04 pKA1U5 GGACAACTCGGTGGTGGCCACTGCGCAGACCANCCCTTCGCTCGTACTCGTGCGCCTCGC
ARe61H09 pKA1U5 GACAACTCGGTGGTGGCCACTGCGCAGACCAGNCCTTTNNTCGTACTCGTGCGCCTCGCT
ARe61H10 pKA1U5 GGNCTNGCTCCGTGGGNGGCGACTGCNCAGACGCCCCNTTNANTNGNACTCGGTGAGCCT
ARe73F05 pKA1U5 GGACAACTCGGTGGTGGCCACTGCGCAGACCAGNCTTCGCNTCGTACTCGTGCGCCTCGC
ARe74C09 pKA1U5 GGACAACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCGCT
ARe75G03 pKA1U5 AACTCGGTGGTGGCCACTGCGCAGACCAGACTNCNNTTNGATACTCGTGCGCCTCGCTTC
ARe75H10 pKA1U5 AACTCGGTGGTGGCCACTGCGCAGACCAGACTCCNNTTNGATACTCGTGCGCCTCGCTTC
ARe77A07 pKA1U5 GGACAACTCGGTGGTGGCCACTGCGCAGACCANCCTTCGCTCGTACTCGTGCGCCTCGCT
ARe81H07 pKA1U5 GGACAACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCGCT
ARe83C09 pKA1U5 TTGAACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCGCTT
ARe85G08 pKA1U5 GGACAACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCGCT
ARe90E02 pKA1U5 ATCCTGAACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCG
ARe93C07 pKA1U5 AACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCGCTTCGC
ARe93D11 pKA1U5 ACAACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGCTACTCGTGCGCCTCGCTT
ARe98G10 pKA1U5 GGACAACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCGCT
ARf01A11 pKA1U5 ATCCTGAACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCG
ARf07B01 pKA1U5 GGACAACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCGTCGTACTCGTGCGCCTCGC
ARi09E05 pGCAP10 AACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCGCTTCGC
ARi09G11 pGCAP10 TAACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCGCTTCG
ARi15A02 pGCAP10 GGACAACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCGCT
ARi15G01 pGCAP10 GGACAACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCGCT
ARi22F09 pGCAP10 GGACAACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCGCT
ARi30F06 pGCAP10 AACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCGCTTCGC
ARi32F01 pGCAP10 AACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCGCTTCGC
ARi34H06 pGCAP10 AACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCGCTTCGC
ARi45B05 pGCAP10 GGACAACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCGCT
ARi54C03 pGCAP10 AACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCGCTTCGC
ARi55F08 pGCAP10 GGACAACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCGCT
ARi56G12 pGCAP10 GGACAACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCGCT
ARi58D03 pGCAP10 AACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCGCTTCGC
ARi59E04 pGCAP10 GGACAACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCGCT
ARi62E03 pGCAP10 AGAACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCGCTTC
ARi62F04 pGCAP10 CGGCCGGCCGATAACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGC
ARi63C04 pGCAP10 AACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCGCTTCGC
ARi67B07 pGCAP10 GCGACAACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCGC
ARi67G08 pGCAP10 AACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCGCTTCGC
ARiS008C09 pGCAP10 GAGACTTCGCTCGNACTCGTGCGCCTCGCTTCGCTTTTCCTCCGCAACCATGTCTGACAA
ARiS008C22 pGCAP10 GGACAACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCGCT
ARiS013D22 pGCAP10 GGACAACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCGCT
ARiS013H19 pGCAP10 GGACAACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCGCT
ARiS013I17 pGCAP10 GGACAACTCGGTGGTGNCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCGCT
ARiS020D20 pGCAP10 GAACANCTCGNCGGCGGCCACTGCGCAAACCANACTTCTCTCGTNCTCCNGCGCCTCGCT
ARiS020F14 pGCAP10 GGACAACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCGCT
ARiS020H16 pGCAP10 AACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCGCTTCGC
ARiS045H08 pGCAP10 GGACAACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCGCT
ARiS045N18 pGCAP10 GGACAACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCGCT
ARiS049H24 pGCAP10 AACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCGCTTCGC
ARiS055J21 pGCAP10 AACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCGCTTCGC
ARiS085J03 pGCAP10 GTTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTTC
ARiS085J04 pGCAP10 CGGCCGGCCGATGGACAACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTC
ARiS087C24 pGCAP10
ARiS087F04 pGCAP10 GGACAACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCGCT
ARiS118C12 pGCAP10 GGACAACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCGCT
ARiS118L07 pGCAP10 GGACAACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCGCT
ARiS118N15 pGCAP10 GGACAACTCNNTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCGCT
ARiS150C11 pGCAP10 GGACAACTCGGTGGTGGCCACTGNNCANACCAGACTTCGCTCGTACTCGTGCGCCTCGCT
ARiS194F16 pGCAP10 AACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCGCTTCGC
ARiS198F08 pGCAP10 AACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCGCTTCGC
RBb01F11 pKA1U5 GGACAACTCGGTGGTGGCCACTGCGCAGACCACANTTCGCTCGTACTCGTGCGCCTCGCT
RBb07F12 pKA1U5 AACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCGCTTCGC
RBb08D03 pKA1U5 TGAGACAAAGGGATCTGGGCTTGAGAAAGCAAGAGCTGGGAGCTCAGCTTTGTTCCTGTT
RBb09A02 pKA1U5 TGAACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCGCTTC
RBb19F06 pKA1U5 GATTCCCTAAATCCGAGCCCGAGTGGTTCTCCCCGGGAAGGCTACTTTGGGGAGCTGGGG
RBb50H12 pGCAP1 TGGACAACTCGGTGGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCG
RBb54A10 pGCAP1 ACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCGCTTCGCT
RBb60C10 pGCAP1 AAATGTGAACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTC
RBb64A03 pGCAP1
RBb67D11 pGCAP1 TTTTTAACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCGC
RBb70A03 pGCAP1 AACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCGCTTCGC
RBb71A08 pGCAP1 TGAACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCGCTTC
RBd14A02 pGCAP10 AACTCGGTGGTGGCCACTGCGCAGACCATGACTTCGCTCGTACTCGTGCGCCTCGCTTCG
RBd18H01 pGCAP10 GGACAACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCGCT
RBd24A02 pGCAP10 AACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCGCTTCGC
RBd32B04 pGCAP10 AACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCGCTTCGC
RBd39D03 pGCAP10 AACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCGCTTCGC
RBd39D04 pGCAP10 TGGCAGTGGTGTGGAGCGCGCCGGGTCCCGGAGCCGGCTGTCTGAGGGATGGACGAGACG
RBd48H09 pGCAP10 GACAACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCGCTT
RBd51G07 pGCAP10 AACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCGCTTCGC
RBd52D05 pGCAP10 GACAACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCGCTT
RBd54G01 pGCAP10 GAATTGGACAACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCC
RBd57C11 pGCAP10 GAAACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCGCTTC
RBd61E08 pGCAP10 TGAACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCGCTTC
RBd66F03 pGCAP10 GGACAACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCGCT
RBd90B01 pGCAP10 AACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCGCTTCGC
RBdS007E06 pGCAP10 AACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCGCTTCGC
RBdS013J03 pGCAP10 AACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCGCTTCGC
RBdS015C16 pGCAP10 AACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCGCTTCGC
RBdS015F22 pGCAP10 GGACAACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCGCT
RBdS040O04 pGCAP10 AACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCGCTTCGC
RBdS070D14 pGCAP10 AACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCGCTTCGC
RBdS070F24 pGCAP10 GGACAACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCGCT
RBdS075D20 pGCAP10 GGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCGCTTCGCTTTTCCTCCGCAACCATGT
RBdS083C24 pGCAP10 GAACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCGCTTCG
RBdS104O15 pGCAP10 GGACAACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCGCT
RBdS132A23 pGCAP10 TGGACAACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCGC
RBdS177A02 pGCAP10 GGACAACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCGCT
RBdS177N07 pGCAP10 GGACAACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCGCT
RBdS156C01 pGCAP10 GGACAACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCGCT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl