Prev. |  KEGG KO K05764 > 

RIKEN DNA Bank Human Resource - TMSB4X

Gene ID NCBI Gene 7114 |  KEGG hsa:7114
Gene Symbol TMSB4X
Protein Name thymosin beta 4, X-linked
Synonyms FX|PTMB4|TB4X|TMSB4
Ortholog resources KEGG ortholog (KEGG orthology K05764) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX056112 IRAK140E16 pCMV-SPORT6 BC064954 NM_021109 Full
HGX056613 IRAK141I21 pCMV-SPORT6 BC061586 NM_021109 Full
HGY083377 IRAL008H09 pOTB7 BC001631 NM_021109 Full
HGY092971 IRAL032H03 pDNR-LIB BC016732 NM_021109 Full
HGY092980 IRAL032H12 pDNR-LIB BC022857 NM_021109 Full
HGY100517 IRAL051E21 pDNR-LIB BC062436 NM_021109 Full
HGY102811 IRAL057A11 pDNR-LIB BC070248 NM_021109 Full
HGY102945 IRAL057G01 pDNR-LIB BC083509 NM_021109 Full
HGY103112 IRAL057M24 pDNR-LIB BC070249 NM_021109 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR040880 ARe02D08 pKA1U5 NM_021109.3  
GGACAACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCGCT
HKR043228 ARe08B04 pKA1U5 NM_021109.3  
GGACAACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCGCT
HKR046097 ARe15E01 pKA1U5 NM_021109.3  
AACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCGCTTCGC
HKR048925 ARe22F05 pKA1U5 NM_021109.3  
AACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCGCTTCGC
HKR050484 ARe26D12 pKA1U5 NM_021109.3  
GGACAACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCGCT
HKR054125 ARe35F05 pKA1U5 NM_021109.3  
GGACAACTCGGTGGTGGCCACTGCGCAGACCANCACTTCGCTCGTACTCGTGCGCCTCGC
HKR058025 ARe45B01 pKA1U5 NM_021109.3  
GAACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCGCTTCG
HKR058476 ARe46D04 pKA1U5 NM_021109.3  
ATCCTGAACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCG
HKR060806 ARe52A06 pKA1U5 NM_021109.3  
TGGTGAACTCGGTGGTGGCCACTGCGCAGACCACCACTTCGCTCGTACTCGTGCGCCTCG
HKR061377 ARe53H09 pKA1U5 NM_021109.3  
ATCCTGAACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCG
HKR063253 ARe58C05 pKA1U5 NM_021109.3  
TGAACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCGCTTC
HKR063306 ARe58E10 pKA1U5 NM_021109.3  
GGACAACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCGCT
HKR063730 ARe59F10 pKA1U5 NM_021109.3  
ATCCTGAACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCG
HKR064525 ARe61F05 pKA1U5 NM_021109.3  
GGACAACTCGGTGGTGGCCACTGCGCAGACCANCCTTCGCTCGTACTCGTGCGCCTCGCT
HKR064548 ARe61G04 pKA1U5 NM_021109.3  
GGACAACTCGGTGGTGGCCACTGCGCAGACCANCCCTTCGCTCGTACTCGTGCGCCTCGC
HKR064577 ARe61H09 pKA1U5 NM_021109.3  
GACAACTCGGTGGTGGCCACTGCGCAGACCAGNCCTTTNNTCGTACTCGTGCGCCTCGCT
HKR064578 ARe61H10 pKA1U5 NM_021109.3  
GGNCTNGCTCCGTGGGNGGCGACTGCNCAGACGCCCCNTTNANTNGNACTCGGTGAGCCT
HKR069325 ARe73F05 pKA1U5 NM_021109.3  
GGACAACTCGGTGGTGGCCACTGCGCAGACCAGNCTTCGCNTCGTACTCGTGCGCCTCGC
HKR069657 ARe74C09 pKA1U5 NM_021109.3  
GGACAACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCGCT
HKR070147 ARe75G03 pKA1U5 NM_021109.3  
AACTCGGTGGTGGCCACTGCGCAGACCAGACTNCNNTTNGATACTCGTGCGCCTCGCTTC
HKR070178 ARe75H10 pKA1U5 NM_021109.3  
AACTCGGTGGTGGCCACTGCGCAGACCAGACTCCNNTTNGATACTCGTGCGCCTCGCTTC
HKR070807 ARe77A07 pKA1U5 NM_021109.3  
GGACAACTCGGTGGTGGCCACTGCGCAGACCANCCTTCGCTCGTACTCGTGCGCCTCGCT
HKR072575 ARe81H07 pKA1U5 NM_021109.3  
GGACAACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCGCT
HKR073257 ARe83C09 pKA1U5 NM_021109.3  
TTGAACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCGCTT
HKR074152 ARe85G08 pKA1U5 NM_021109.3  
GGACAACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCGCT
HKR076098 ARe90E02 pKA1U5 NM_021109.3  
ATCCTGAACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCG
HKR077255 ARe93C07 pKA1U5 NM_021109.3  
AACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCGCTTCGC
HKR077283 ARe93D11 pKA1U5 NM_021109.3  
ACAACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGCTACTCGTGCGCCTCGCTT
HKR079354 ARe98G10 pKA1U5 NM_021109.3  
GGACAACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCGCT
HKR080411 ARf01A11 pKA1U5 NM_021109.3  
ATCCTGAACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCG
HKR082825 ARf07B01 pKA1U5 NM_021109.3  
GGACAACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCGTCGTACTCGTGCGCCTCGC
HKR163701 ARi09E05 pGCAP10 NM_021109.3  
AACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCGCTTCGC
HKR163755 ARi09G11 pGCAP10 NM_021109.3  
TAACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCGCTTCG
HKR166002 ARi15A02 pGCAP10 NM_021109.3  
GGACAACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCGCT
HKR166145 ARi15G01 pGCAP10 NM_021109.3  
GGACAACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCGCT
HKR168929 ARi22F09 pGCAP10 NM_021109.3  
GGACAACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCGCT
HKR172126 ARi30F06 pGCAP10 NM_021109.3  
AACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCGCTTCGC
HKR172921 ARi32F01 pGCAP10 NM_021109.3  
AACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCGCTTCGC
HKR173774 ARi34H06 pGCAP10 NM_021109.3  
AACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCGCTTCGC
HKR178029 ARi45B05 pGCAP10 NM_021109.3  
GGACAACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCGCT
HKR181651 ARi54C03 pGCAP10 NM_021109.3  
AACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCGCTTCGC
HKR182128 ARi55F08 pGCAP10 NM_021109.3  
GGACAACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCGCT
HKR182556 ARi56G12 pGCAP10 NM_021109.3  
GGACAACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCGCT
HKR183275 ARi58D03 pGCAP10 NM_021109.3  
AACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCGCTTCGC
HKR183700 ARi59E04 pGCAP10 NM_021109.3  
GGACAACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCGCT
HKR184899 ARi62E03 pGCAP10 NM_021109.3  
AGAACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCGCTTC
HKR184924 ARi62F04 pGCAP10 NM_021109.3  
CGGCCGGCCGATAACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGC
HKR185252 ARi63C04 pGCAP10 NM_021109.3  
AACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCGCTTCGC
HKR186831 ARi67B07 pGCAP10 NM_021109.3  
GCGACAACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCGC
HKR186952 ARi67G08 pGCAP10 NM_021109.3  
AACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCGCTTCGC
HKR203257 ARiS008C09 pGCAP10 NM_021109.3  
GAGACTTCGCTCGNACTCGTGCGCCTCGCTTCGCTTTTCCTCCGCAACCATGTCTGACAA
HKR203270 ARiS008C22 pGCAP10 NM_021109.3  
GGACAACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCGCT
HKR205294 ARiS013D22 pGCAP10 NM_021109.3  
GGACAACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCGCT
HKR205387 ARiS013H19 pGCAP10 NM_021109.3  
GGACAACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCGCT
HKR205409 ARiS013I17 pGCAP10 NM_021109.3  
GGACAACTCGGTGGTGNCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCGCT
HKR208092 ARiS020D20 pGCAP10 NM_021109.3  
GAACANCTCGNCGGCGGCCACTGCGCAAACCANACTTCTCTCGTNCTCCNGCGCCTCGCT
HKR208134 ARiS020F14 pGCAP10 NM_021109.3  
GGACAACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCGCT
HKR208184 ARiS020H16 pGCAP10 NM_021109.3  
AACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCGCTTCGC
HKR218176 ARiS045H08 pGCAP10 NM_021109.3  
GGACAACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCGCT
HKR218330 ARiS045N18 pGCAP10 NM_021109.3  
GGACAACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCGCT
HKR219792 ARiS049H24 pGCAP10 NM_021109.3  
AACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCGCTTCGC
HKR222237 ARiS055J21 pGCAP10 NM_021109.3  
AACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCGCTTCGC
HKR234219 ARiS085J03 pGCAP10 NM_021109.3  
GTTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTTC
HKR234220 ARiS085J04 pGCAP10 NM_021109.3  
CGGCCGGCCGATGGACAACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTC
HKR234872 ARiS087C24 pGCAP10 NM_021109.3  
HKR234924 ARiS087F04 pGCAP10 NM_021109.3  
GGACAACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCGCT
HKR247260 ARiS118C12 pGCAP10 NM_021109.3  
GGACAACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCGCT
HKR247471 ARiS118L07 pGCAP10 NM_021109.3  
GGACAACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCGCT
HKR247527 ARiS118N15 pGCAP10 NM_021109.3  
GGACAACTCNNTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCGCT
HKR260059 ARiS150C11 pGCAP10 NM_021109.3  
GGACAACTCGGTGGTGGCCACTGNNCANACCAGACTTCGCTCGTACTCGTGCGCCTCGCT
HKR277736 ARiS194F16 pGCAP10 NM_021109.3  
AACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCGCTTCGC
HKR279328 ARiS198F08 pGCAP10 NM_021109.3  
AACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCGCTTCGC
HKR320531 RBb01F11 pKA1U5 NM_021109.3  
GGACAACTCGGTGGTGGCCACTGCGCAGACCACANTTCGCTCGTACTCGTGCGCCTCGCT
HKR322932 RBb07F12 pKA1U5 NM_021109.3  
AACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCGCTTCGC
HKR323275 RBb08D03 pKA1U5 NM_021109.3  
TGAGACAAAGGGATCTGGGCTTGAGAAAGCAAGAGCTGGGAGCTCAGCTTTGTTCCTGTT
HKR323602 RBb09A02 pKA1U5 NM_021109.3  
TGAACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCGCTTC
HKR327726 RBb19F06 pKA1U5 NM_021109.3  
GATTCCCTAAATCCGAGCCCGAGTGGTTCTCCCCGGGAAGGCTACTTTGGGGAGCTGGGG
HKR340180 RBb50H12 pGCAP1 NM_021109.3  
TGGACAACTCGGTGGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCG
HKR341610 RBb54A10 pGCAP1 NM_021109.3  
ACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCGCTTCGCT
HKR344058 RBb60C10 pGCAP1 NM_021109.3  
AAATGTGAACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTC
HKR345603 RBb64A03 pGCAP1 NM_021109.3  
HKR346883 RBb67D11 pGCAP1 NM_021109.3  
TTTTTAACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCGC
HKR348003 RBb70A03 pGCAP1 NM_021109.3  
AACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCGCTTCGC
HKR348408 RBb71A08 pGCAP1 NM_021109.3  
TGAACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCGCTTC
HKR365602 RBd14A02 pGCAP10 NM_021109.3  
AACTCGGTGGTGGCCACTGCGCAGACCATGACTTCGCTCGTACTCGTGCGCCTCGCTTCG
HKR367369 RBd18H01 pGCAP10 NM_021109.3  
GGACAACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCGCT
HKR369602 RBd24A02 pGCAP10 NM_021109.3  
AACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCGCTTCGC
HKR372828 RBd32B04 pGCAP10 NM_021109.3  
AACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCGCTTCGC
HKR375675 RBd39D03 pGCAP10 NM_021109.3  
AACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCGCTTCGC
HKR375676 RBd39D04 pGCAP10 NM_021109.3  
TGGCAGTGGTGTGGAGCGCGCCGGGTCCCGGAGCCGGCTGTCTGAGGGATGGACGAGACG
HKR379377 RBd48H09 pGCAP10 NM_021109.3  
GACAACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCGCTT
HKR380551 RBd51G07 pGCAP10 NM_021109.3  
AACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCGCTTCGC
HKR380877 RBd52D05 pGCAP10 NM_021109.3  
GACAACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCGCTT
HKR381745 RBd54G01 pGCAP10 NM_021109.3  
GAATTGGACAACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCC
HKR382859 RBd57C11 pGCAP10 NM_021109.3  
GAAACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCGCTTC
HKR384504 RBd61E08 pGCAP10 NM_021109.3  
TGAACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCGCTTC
HKR386523 RBd66F03 pGCAP10 NM_021109.3  
GGACAACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCGCT
HKR396025 RBd90B01 pGCAP10 NM_021109.3  
AACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCGCTTCGC
HKR402902 RBdS007E06 pGCAP10 NM_021109.3  
AACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCGCTTCGC
HKR405419 RBdS013J03 pGCAP10 NM_021109.3  
AACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCGCTTCGC
HKR406064 RBdS015C16 pGCAP10 NM_021109.3  
AACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCGCTTCGC
HKR406142 RBdS015F22 pGCAP10 NM_021109.3  
GGACAACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCGCT
HKR416340 RBdS040O04 pGCAP10 NM_021109.3  
AACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCGCTTCGC
HKR428086 RBdS070D14 pGCAP10 NM_021109.3  
AACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCGCTTCGC
HKR428144 RBdS070F24 pGCAP10 NM_021109.3  
GGACAACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCGCT
HKR430092 RBdS075D20 pGCAP10 NM_021109.3  
GGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCGCTTCGCTTTTCCTCCGCAACCATGT
HKR433272 RBdS083C24 pGCAP10 NM_021109.3  
GAACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCGCTTCG
HKR441951 RBdS104O15 pGCAP10 NM_021109.3  
GGACAACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCGCT
HKR452823 RBdS132A23 pGCAP10 NM_021109.3  
TGGACAACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCGC
HKR462449 RBdS156C01 pGCAP10 NM_021109.3  
GGACAACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCGCT
HKR470802 RBdS177A02 pGCAP10 NM_021109.3  
GGACAACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCGCT
HKR471119 RBdS177N07 pGCAP10 NM_021109.3  
GGACAACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCGCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.17

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl