Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00195

HP ID(1) HP00195
Gene ID(2) 5034
Gene Symbol finder P4HB
Protein Name prolyl 4-hydroxylase, beta polypeptide
RefSeq NM_000918.3
Length of RefSeq (bp) 2596
Chromosome 17q25
Reference DDBJ accession
UniGene Hs.464336

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe09D05 pKA1U5 GGCCCCGGACCCAGGATTTATAAAGGCGAGGCCGGGACCGGCGCGCGCTCTCGTCGCCCC
ARe18D05 pKA1U5 GGCTCTCGTCGCCCCCGCTGTCCCGGCGGCGCCAACCGAAGCGCCCCGCCTGATCCGTGT
ARe21F06 pKA1U5 GAGGATTTATAANGGCGAGGCCGGNACCGGCCCCNTTCTNTTCATCNCCCCCGCCTGTCC
ARe33B08 pKA1U5 GGCTCTCGTCGCCCCCGCTGTCCCGGCGGCGCCAACCGAAGCGCCCCGCCTGATCCGTGT
ARe49B03 pKA1U5 GGCTCTCGTCGCCCCCGCTGTCCCGGCGGCGCCAACCGAAGCGCCCCGCCTGATCCGTGT
ARe58G12 pKA1U5 GAGGATTTATAAAGGCGAGGCCGGGACCGGCGCGCGCTCTCGTCGCCCCCGCTGTCCCGG
ARe82D10 pKA1U5 TTGCTCTCGTCGCCCCCGCTGTCCCGGCGGCGCCAACCGAAGCGCCCCGCCTGATCCGTG
ARe99H06 pKA1U5 ATCCTGGCTCGTCGCCCCCGCTGTCCCGGCGGCGCCAACCGAAGCGCCCCGCCTGATCCG
ARf04E09 pKA1U5 GGCTCTCGTCGCCCCCGCTGTCCCGGCGGCGCCAACCGAAGCGCCCCGCCTGATCCGTGT
ARi10H09 pGCAP10 GGCTCTCGTCGCCCCCGCTGTCCCGGCGGCGCCAACCGAAGCGCCCCGCCTGATCCGTGT
ARi13H08 pGCAP10 GGCTCTCGTCGCCCCCGCTGTCCCGGCGGCGCCAACCGAAGCGCCCCGCCTGATCCGTGT
ARi45E09 pGCAP10 GCTCGTCGCCCCCGCTGTCCCGGCGGCGCCAACCGAAGCGCCCCGCCTGATCCGTGTCCG
ARi58E11 pGCAP10 GGTCGCCCCCGCTGTCCCGGCGGCGCCAACCGAAGCGCCCCGCCTGATCCGTGTCCGACA
ARiS045B17 pGCAP10
ARiS049C23 pGCAP10 GCTCTCGTCGCCCCCGCTGTCCCGGCGGCGCCAACCGAAGCGCCCCGCCTGATCCGTGTC
ARiS088O01 pGCAP10 TGGCTCTCGTCGCCCCCGCTGTCCCGGCGGCGCCAACCGAAGCGCCCCGCCTGATCCGTG
ARiS122I09 pGCAP10 GGCTCTCGTCGCCCCCGCTGTCCCGGCGGCGCCAACCGAAGCGCCCCGCCTGATCCGTGT
ARiS191B02 pGCAP10 GAGGATTTATAAAGGCGAGGCCGGGACCGGCGCGCGCTCTCGTCGCCCCCGCTGTCCCGG
ARiS198D02 pGCAP10 TGGCTCTCGTCGCCCCCGCTGTCCCGGCGGCGCCAACCGAAGCGCCCCGCCTGATCCGTG
RBb10B02 pKA1U5 GAGGCGCGCCCCGGACCCAGGATTTATAAAGGCNANNCCGGGNACCGGCGCGCGCTCTCG
RBb34G07 pGCAP1 GCTCTCGTCGCCCCCGCTGTCCCGGCGGCGCCAACCGAAGCGCCCCGCCTGCTCCGTGTC
RBb39B12 pGCAP1 GCCTGCTCCGTGTCCGACATGCTGCGCCGCGCTCTGCTGTGCCTGGCCGTGGCCGCCCTG
RBb56G11 pGCAP1 GGCGCTCTCGTTCNCCCCCGCTTGNTCCCGGCGGCGCCAACCGTAAGCGCCCCGCCTGCT
RBd27E05 pGCAP10 CGGCCGGCCGATGGCTCTCGTCGCCCCGCTGTCCGGCGGCGCCACCGAAGCGCCCCGCCT
RBd28C08 pGCAP10 GAGCGCGCGCGGGCGGGGGGGCAGGCGCGCCCCGGACCCAGGATTTATAAAGGCGAGGCC
RBd32E08 pGCAP10 GGCTCTCGTCGCCCCCGCTGTCCCGGCGGCGCCAACCGAAGCGCCCCGCCTGCTCCGTGT
RBd46G06 pGCAP10 GAGGATTTATAAAGGCGAGGCCGGGACCGGCGCGCGCTCTCGTCGCCCCCGCTGTCCCGG
RBd62D08 pGCAP10 GGCTCTCGTCGCCCCCGCTGTCCCGGCGGCGCCAACCGAAGCGCCCCGCCTGCTCCGTGT
RBdS081I13 pGCAP10 GGCTCTCGTCGCCCCCGCTGTCCCGGCGGCGCCAACCGAAGCGCCCCGCCTGCTCCGTGT
RBdS104B18 pGCAP10 GGCTCTCGTCGCCCCCGCTGTCCCGGCGGCGCCAACCGAAGCGCCCCGCCTGCTCCGTGT
RBdS154D11 pGCAP10 TGGGCGCTCTCGTCGCCCCCGCTGTCCCGGCGGCGCCAACCGAAGCGCCCCGCCTGCTCC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl