Prev. |  KEGG KO K09580 > 

RIKEN DNA Bank Human Resource - P4HB

Gene ID NCBI Gene 5034 |  KEGG hsa:5034
Gene Symbol P4HB
Protein Name prolyl 4-hydroxylase subunit beta
Synonyms CLCRP1|DSI|ERBA2L|GIT|P4Hbeta|PDI|PDIA1|PHDB|PO4DB|PO4HB|PROHB
Ortholog resources KEGG ortholog (KEGG orthology K09580) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB04508 SEREX clone BRC-Co-9 #1 SEREX clone BRC-Co-9 #1
RDB05511 pKM2L-phP4HB Promoter Bank clone, Human prolyl 4-hydroxylase beta-subunit and disulfide isomerase (P4HB) promoter

RDB_org_190226.csv


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX005689 IRAK014D17 pCMV-SPORT6 BC010859 NM_000918 Full
HGX008220 IRAK020J04 pCMV-SPORT6 BC029617 NM_000918 Full
HGY103321 IRAL058F01 pOTB7 BC071892 NM_000918 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE007436 W01A018J20 pENTR-TOPO IRAK014D17 BC010859 NM_000918  
HGE007438 W01A018J22 pENTR-TOPO IRAK014D17 BC010859 NM_000918  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR043677 ARe09D05 pKA1U5 NM_000918.3  
GGCCCCGGACCCAGGATTTATAAAGGCGAGGCCGGGACCGGCGCGCGCTCTCGTCGCCCC
HKR047277 ARe18D05 pKA1U5 NM_000918.3  
GGCTCTCGTCGCCCCCGCTGTCCCGGCGGCGCCAACCGAAGCGCCCCGCCTGATCCGTGT
HKR048526 ARe21F06 pKA1U5 NM_000918.3  
GAGGATTTATAANGGCGAGGCCGGNACCGGCCCCNTTCTNTTCATCNCCCCCGCCTGTCC
HKR053232 ARe33B08 pKA1U5 NM_000918.3  
GGCTCTCGTCGCCCCCGCTGTCCCGGCGGCGCCAACCGAAGCGCCCCGCCTGATCCGTGT
HKR059627 ARe49B03 pKA1U5 NM_000918.3  
GGCTCTCGTCGCCCCCGCTGTCCCGGCGGCGCCAACCGAAGCGCCCCGCCTGATCCGTGT
HKR063356 ARe58G12 pKA1U5 NM_000918.3  
GAGGATTTATAAAGGCGAGGCCGGGACCGGCGCGCGCTCTCGTCGCCCCCGCTGTCCCGG
HKR072882 ARe82D10 pKA1U5 NM_000918.3  
TTGCTCTCGTCGCCCCCGCTGTCCCGGCGGCGCCAACCGAAGCGCCCCGCCTGATCCGTG
HKR079774 ARe99H06 pKA1U5 NM_000918.3  
ATCCTGGCTCGTCGCCCCCGCTGTCCCGGCGGCGCCAACCGAAGCGCCCCGCCTGATCCG
HKR081705 ARf04E09 pKA1U5 NM_000918.3  
GGCTCTCGTCGCCCCCGCTGTCCCGGCGGCGCCAACCGAAGCGCCCCGCCTGATCCGTGT
HKR164177 ARi10H09 pGCAP10 NM_000918.3  
GGCTCTCGTCGCCCCCGCTGTCCCGGCGGCGCCAACCGAAGCGCCCCGCCTGATCCGTGT
HKR165376 ARi13H08 pGCAP10 NM_000918.3  
GGCTCTCGTCGCCCCCGCTGTCCCGGCGGCGCCAACCGAAGCGCCCCGCCTGATCCGTGT
HKR178105 ARi45E09 pGCAP10 NM_000918.3  
GCTCGTCGCCCCCGCTGTCCCGGCGGCGCCAACCGAAGCGCCCCGCCTGATCCGTGTCCG
HKR183307 ARi58E11 pGCAP10 NM_000918.3  
GGTCGCCCCCGCTGTCCCGGCGGCGCCAACCGAAGCGCCCCGCCTGATCCGTGTCCGACA
HKR218041 ARiS045B17 pGCAP10 NM_000918.3  
HKR219671 ARiS049C23 pGCAP10 NM_000918.3  
GCTCTCGTCGCCCCCGCTGTCCCGGCGGCGCCAACCGAAGCGCCCCGCCTGATCCGTGTC
HKR235537 ARiS088O01 pGCAP10 NM_000918.3  
TGGCTCTCGTCGCCCCCGCTGTCCCGGCGGCGCCAACCGAAGCGCCCCGCCTGATCCGTG
HKR249001 ARiS122I09 pGCAP10 NM_000918.3  
GGCTCTCGTCGCCCCCGCTGTCCCGGCGGCGCCAACCGAAGCGCCCCGCCTGATCCGTGT
HKR276426 ARiS191B02 pGCAP10 NM_000918.3  
GAGGATTTATAAAGGCGAGGCCGGGACCGGCGCGCGCTCTCGTCGCCCCCGCTGTCCCGG
HKR279274 ARiS198D02 pGCAP10 NM_000918.3  
TGGCTCTCGTCGCCCCCGCTGTCCCGGCGGCGCCAACCGAAGCGCCCCGCCTGATCCGTG
HKR324026 RBb10B02 pKA1U5 NM_000918.3  
GAGGCGCGCCCCGGACCCAGGATTTATAAAGGCNANNCCGGGNACCGGCGCGCGCTCTCG
HKR333751 RBb34G07 pGCAP1 NM_000918.3  
GCTCTCGTCGCCCCCGCTGTCCCGGCGGCGCCAACCGAAGCGCCCCGCCTGCTCCGTGTC
HKR335636 RBb39B12 pGCAP1 NM_000918.3  
GCCTGCTCCGTGTCCGACATGCTGCGCCGCGCTCTGCTGTGCCTGGCCGTGGCCGCCCTG
HKR342555 RBb56G11 pGCAP1 NM_000918.3  
GGCGCTCTCGTTCNCCCCCGCTTGNTCCCGGCGGCGCCAACCGTAAGCGCCCCGCCTGCT
HKR370901 RBd27E05 pGCAP10 NM_000918.3  
CGGCCGGCCGATGGCTCTCGTCGCCCCGCTGTCCGGCGGCGCCACCGAAGCGCCCCGCCT
HKR371256 RBd28C08 pGCAP10 NM_000918.3  
GAGCGCGCGCGGGCGGGGGGGCAGGCGCGCCCCGGACCCAGGATTTATAAAGGCGAGGCC
HKR372904 RBd32E08 pGCAP10 NM_000918.3  
GGCTCTCGTCGCCCCCGCTGTCCCGGCGGCGCCAACCGAAGCGCCCCGCCTGCTCCGTGT
HKR378550 RBd46G06 pGCAP10 NM_000918.3  
GAGGATTTATAAAGGCGAGGCCGGGACCGGCGCGCGCTCTCGTCGCCCCCGCTGTCCCGG
HKR384880 RBd62D08 pGCAP10 NM_000918.3  
GGCTCTCGTCGCCCCCGCTGTCCCGGCGGCGCCAACCGAAGCGCCCCGCCTGCTCCGTGT
HKR432605 RBdS081I13 pGCAP10 NM_000918.3  
GGCTCTCGTCGCCCCCGCTGTCCCGGCGGCGCCAACCGAAGCGCCCCGCCTGCTCCGTGT
HKR441642 RBdS104B18 pGCAP10 NM_000918.3  
GGCTCTCGTCGCCCCCGCTGTCCCGGCGGCGCCAACCGAAGCGCCCCGCCTGCTCCGTGT
HKR461683 RBdS154D11 pGCAP10 NM_000918.3  
TGGGCGCTCTCGTCGCCCCCGCTGTCCCGGCGGCGCCAACCGAAGCGCCCCGCCTGCTCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl