Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00187

HP ID(1) HP00187
Gene ID(2) 10381
Gene Symbol finder TUBB3
Protein Name tubulin, beta 3
RefSeq NM_006086.2
Length of RefSeq (bp) 1736
Chromosome 16q24.3
Reference DDBJ accession
UniGene Hs.511743

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe25A10 pKA1U5 ATCCTGGAGCAGCCAGCCCGGCCCGCCCGCGCCCGATCCGCAGCCGCCCGCCAGACGCGC
RBb15H10 pKA1U5 GCAGCAGCCAGCCCGGCCCGCCCGCGCCCGTCCNCATNCGCCCGCCAGACGCGCCCAGTA
RBb43F02 pGCAP1 AGCAGCCAGCCCGGCCCGCCCGCGCCCGTCCGCAGCCGCCCGCCAGACGCGCCCAGTATG
RBb54C07 pGCAP1 GCCTCAGCAGCCAGCCCGGCCCGCCCGCGCCCGTCCGCAGCCGCCCGCCAGACGCGCCCA
RBd11F01 pGCAP10 GCTCAGCAGCCAGCCCGGCCCGCCCGCGCCCGTCCGCAGCCGCCCGCCAGACGCGCCCAG
RBd56D09 pGCAP10 GCTCAGCAGCCAGCCCGGCCCGCCCGCGCCCGTCCGCAGCCNCCNNNCAGACGCGCCCAG
RBdS007O17 pGCAP10 GCCCTCAGCAGCCAGCCCGGCCCGCCCGCGCCCGTCCGCAGCCGCCCGCCAGACGCGCCC
RBdS105P14 pGCAP10 GAGCAGCCAGCCCGGCCCGCCCGCGCCCGTCCGCAGCCGCCCGCCAGACGCGCCCAGTAT
RBdS110B14 pGCAP10 GAGCAGCCAGCCCGGCCCGCCCGCGCCCGTCCGCAGCCGCCCGCCAGACGCGCCCAGTAT
RBdS110D16 pGCAP10 GCTCAGCAGCCAGCCCGGCCCGCCCGCGCCCGTCCGCAGCCGCCCGCCAGACGCGCCCAG
RBdS132O14 pGCAP10 GCTCANCAGCCAGCCCGGCCCGCCCGCGCCCGTCCGCAGCCGCCCGCCAGACGCGCCCAG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl