DNA Bank Top |  KEGG KO K07375 > 

RIKEN DNA Bank Human Resource - TUBB3

Gene ID NCBI Gene 10381 |  KEGG hsa:10381
Gene Symbol TUBB3
Protein Name tubulin beta 3 class III
Synonyms CDCBM|CDCBM1|CFEOM3|CFEOM3A|FEOM3|TUBB4|beta-4

Link

Ortholog resource in our bank

  TUBB3


External database

human TUBB3

Individualy Deposited Resource

Catalog number Name of Resource Description CDS comparison
Refered (NCBI mRNA) CDS status(1)
RDB14531 pFBD-Hs alpha1(K40R) CFXaGH/beta3 CFXaGF Expression vector of His tagged human tubulin alpha-1(mutant, K40R, constitutive active form) and Flag tagged human tubulin beta-3.    
RDB14530 pFBD-Hs alpha1 CFXaGH/beta3 CFXaGF Expression vector of His tagged human tubulin alpha-1and Flag tagged human tubulin beta-3.    
RDB12754 pFBD-Hs alpha1(K40R)CGH/beta3CGF Plasmid clone for baculoviral expression of alpha1 and beta3 tubulin    
RDB12753 pFBD-Hs alpha1CGH/beta3CGF Plasmid clone for baculoviral expression of alpha1 and beta3 tubulin    

(1) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.

webcatalog20240727.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY036536 IRAK091F16 pBluescript BC047518 NM_006086 Partial
HGY081025 IRAL002J09 pOTB7 BC000748 NM_006086 Full
HGY083647 IRAL009B23 pOTB7 BC003021 NM_006086.4 full
HGY081153 IRAL002O17 pOTB7 BC001678 NM_006086 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2024May11.csv
GNP_full_IRAL_2024May11.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR050010 ARe25A10 pKA1U5 NM_006086.2  
ATCCTGGAGCAGCCAGCCCGGCCCGCCCGCGCCCGATCCGCAGCCGCCCGCCAGACGCGC
HKR326178 RBb15H10 pKA1U5 NM_006086.2  
GCAGCAGCCAGCCCGGCCCGCCCGCGCCCGTCCNCATNCGCCCGCCAGACGCGCCCAGTA
HKR337322 RBb43F02 pGCAP1 NM_006086.2  
AGCAGCCAGCCCGGCCCGCCCGCGCCCGTCCGCAGCCGCCCGCCAGACGCGCCCAGTATG
HKR341655 RBb54C07 pGCAP1 NM_006086.2  
GCCTCAGCAGCCAGCCCGGCCCGCCCGCGCCCGTCCGCAGCCGCCCGCCAGACGCGCCCA
HKR364521 RBd11F01 pGCAP10 NM_006086.2  
GCTCAGCAGCCAGCCCGGCCCGCCCGCGCCCGTCCGCAGCCGCCCGCCAGACGCGCCCAG
HKR382481 RBd56D09 pGCAP10 NM_006086.2  
GCTCAGCAGCCAGCCCGGCCCGCCCGCGCCCGTCCGCAGCCNCCNNNCAGACGCGCCCAG
HKR403153 RBdS007O17 pGCAP10 NM_006086.2  
GCCCTCAGCAGCCAGCCCGGCCCGCCCGCGCCCGTCCGCAGCCGCCCGCCAGACGCGCCC
HKR442374 RBdS105P14 pGCAP10 NM_006086.2  
GAGCAGCCAGCCCGGCCCGCCCGCGCCCGTCCGCAGCCGCCCGCCAGACGCGCCCAGTAT
HKR444038 RBdS110B14 pGCAP10 NM_006086.2  
GAGCAGCCAGCCCGGCCCGCCCGCGCCCGTCCGCAGCCGCCCGCCAGACGCGCCCAGTAT
HKR444088 RBdS110D16 pGCAP10 NM_006086.2  
GCTCAGCAGCCAGCCCGGCCCGCCCGCGCCCGTCCGCAGCCGCCCGCCAGACGCGCCCAG
HKR453150 RBdS132O14 pGCAP10 NM_006086.2  
GCTCANCAGCCAGCCCGGCCCGCCCGCGCCCGTCCGCAGCCGCCCGCCAGACGCGCCCAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2024May11.csv
NRCDhumcloneList_RB_2024May11.csv


No Approval Forms Required for Fluorescent Protein Genes Developed by Dr. Atsushi Miyawaki
♦ RIKEN BRC will be closed from December 28, 2024 through January 5, 2025 due to New Year's holidays.
A bicistronic cell cycle reporter, Fucci2a (Sep 17, 2024)
Monomeric Fluorescent Protein Resource, mStayGold (Dec 18, 2023)
Visualization of Organelles update (Dec 18, 2023)
Development of two mouse strains conditionally expressing bright luciferases (Sep 08, 2023)
Autophagy and Mitophagy Updates (Aug 16, 2023)
High intensity forms of luciferase and luminescent proteins from various organisms (BRC RESOURCE NEWS) (Apr 28, 2023)
Plasmid of Cas9 expression/mRNA production, evaluation of the genome edit efficiency, and Knock-in donors and tags
Fucci cell cycle indicator, Calcium sensor and Fluorescent and Luminescent protein resources
Revision of Distribution Fees for Bioresources in RIKEN BRC
- - - - - - - - - - - - - - - - - - - -
Mail News sign-up. Receive information of the forcusd resources, new available resources and more.
♦ Please visit "Terms of Use", "Quality control" and "Ordering instruction"
Dnaconda's recommendation BRC Resource News RIKEN BRC 20th RIKEN BRC News sign-up

2025.03.28

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_240727.pl