Prev. | NRCD Clone U | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00184

HP ID(1) HP00184
Gene ID(2) 7316
Gene Symbol finder UBC
Protein Name ubiquitin C
RefSeq NM_021009.4
Length of RefSeq (bp) 2602
Chromosome 12q24.3
Reference DDBJ accession
UniGene Hs.520348

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe10G03 pKA1U5 GNGTACCTGCCCCATCCGAGAATTTGGATCTCAGTTCTTGTTTGTGNATTGCTGTGATCN
ARe37A04 pKA1U5 GAGTTCCGCTCGCANCCGGGATTTGGGTCGCAGTTTCTTGTTTTGTGGATTGCTGTGATC
ARe48G05 pKA1U5 AGTTCCGTCGCAGCCGGGATTTGGGTCGCAGCTTCTTGNTTTGTGGATTGCTGTGATCGT
ARe55G06 pKA1U5 AGTTCCGTCGCAGCCGGGATTTGGGTCGCGGTNCTTGTTTGTGGATCGCTGTGATCGTCA
ARe68G09 pKA1U5 TAGTTCCGTCGCAGCCGGGATTTGGGTCGCAGCTTCTTGTTTGTGGATTGCTGTGATCGT
ARe75B09 pKA1U5 TGAGTTCCGTCGCAGCCGGGATTTGGGTCGCGGCTTCTTGTTTTGTGGATCGCTGTGATC
ARe75F03 pKA1U5 GAGTTTCCGGTCGCAGCCGGGATTTGGGTCGCGGCTCTTGATTTGATGGATCGCTGTGAT
ARe76A09 pKA1U5 TGGTAGTTCCGTCGCAGCCGGGATTTGGGTCGCATTTCTTGTTTGTGGATTGCTGTGATC
ARe81F03 pKA1U5 AGTTCCGTCGCAGCCGGGATTTGGGTCGCGGTTCTTGTTTGTGGATCGCTGTGATCGTCA
ARe93G12 pKA1U5 GAGTTCCGTCGCAGCCGGGATTTGGGTCGCGGTTCTTGTTTGTGGATCGCTGTGATCGTC
ARe97A11 pKA1U5 GAGTTCCGTCGCAGCCGGGATTTGGGTCGCAGTTCTTGTTTGTGGATTGCTGTGATCGTC
ARf06E01 pKA1U5 GAGTTCCGTCGCAGCCGGGATTTGGGTCGCAGTTCTTGTTTGTGGATTGCTGTGATCGTC
ARi32C07 pGCAP10 GTAGTTCCGTCGCAGCCGGGATTTGGGTCGCAGTTCTTGTTTGTGGATTGCTGTGATCGT
ARiS008D04 pGCAP10 TGAGTTCCGTCGCAGCCGGGATTTGGGTCGCAGTTCTTGTTTGTGGATTGCTGTGATCGT
ARiS023J19 pGCAP10 GAGTTCCGTCGCAGCCGGGATTTGGGTCGCGGTTCTTGTTTGTGGATCGCTGTGATCGTC
RBb37G12 pGCAP1 GAGTTCCGTCGCAGCCGGGATTTGGGTCGCGGTTCTTGTTTGTGGATCGCTGTGATCGTC
RBb52C06 pGCAP1 AGTTTCCGCTCGCAGCCGGGCATTTGGGTCGCGGATTCTTGATTTGNTGGATCGCNTGTG
RBd19A07 pGCAP10 CGGCCGGCCGATGAGGGGCGGTTGGCTTTGTTGGGTGAGCTTGTTTGTGTCCCTGTGGGT
RBd55C06 pGCAP10 GAGTTCCGTCGCAGCCGGGATTTGGGTCGCGGTTCTTGTTTNNGNNNCGCTGTGATCGTC
RBdS013D16 pGCAP10 GAGTTCCGTCGCAGCCNGNATTTGGGTCGCGGTTCTTGTTTGTGGATCGCTGTGATCGTC
RBdS051M03 pGCAP10 GAGTTCCGTCGCAGCCGGGATTTGGGTCGCGGTTCTTGTTTGTGGATCGCTGTGATCGTC
RBdS081F07 pGCAP10 GAGTTCCGTCGCAGCCGGGATTTGGGTCGCGGTTCTTGTTTGTGGATCGCTGTGATCNTC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl