Prev. |  KEGG KO K08770 > 

RIKEN DNA Bank Human Resource - UBC

Gene ID NCBI Gene 7316 |  KEGG hsa:7316
Gene Symbol UBC
Protein Name ubiquitin C
Synonyms HMG20
Ortholog resources KEGG ortholog (KEGG orthology K08770) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY080527 IRAL001F07 pOTB7 BC000449 NM_021009 Full/var
HGY084040 IRAL010B16 pOTB7 BC008955 NM_021009 Partial/var
HGY088561 IRAL021G17 pDNR-LIB BC039193 NM_021009 Full/var
HGY103610 IRAL059A10 pOTB7 BC080583 NM_021009 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR044147 ARe10G03 pKA1U5 NM_021009.4  
GNGTACCTGCCCCATCCGAGAATTTGGATCTCAGTTCTTGTTTGTGNATTGCTGTGATCN
HKR054804 ARe37A04 pKA1U5 NM_021009.4  
GAGTTCCGCTCGCANCCGGGATTTGGGTCGCAGTTTCTTGTTTTGTGGATTGCTGTGATC
HKR059349 ARe48G05 pKA1U5 NM_021009.4  
AGTTCCGTCGCAGCCGGGATTTGGGTCGCAGCTTCTTGNTTTGTGGATTGCTGTGATCGT
HKR062150 ARe55G06 pKA1U5 NM_021009.4  
AGTTCCGTCGCAGCCGGGATTTGGGTCGCGGTNCTTGTTTGTGGATCGCTGTGATCGTCA
HKR067353 ARe68G09 pKA1U5 NM_021009.4  
TAGTTCCGTCGCAGCCGGGATTTGGGTCGCAGCTTCTTGTTTGTGGATTGCTGTGATCGT
HKR070033 ARe75B09 pKA1U5 NM_021009.4  
TGAGTTCCGTCGCAGCCGGGATTTGGGTCGCGGCTTCTTGTTTTGTGGATCGCTGTGATC
HKR070123 ARe75F03 pKA1U5 NM_021009.4  
GAGTTTCCGGTCGCAGCCGGGATTTGGGTCGCGGCTCTTGATTTGATGGATCGCTGTGAT
HKR070409 ARe76A09 pKA1U5 NM_021009.4  
TGGTAGTTCCGTCGCAGCCGGGATTTGGGTCGCATTTCTTGTTTGTGGATTGCTGTGATC
HKR072523 ARe81F03 pKA1U5 NM_021009.4  
AGTTCCGTCGCAGCCGGGATTTGGGTCGCGGTTCTTGTTTGTGGATCGCTGTGATCGTCA
HKR077356 ARe93G12 pKA1U5 NM_021009.4  
GAGTTCCGTCGCAGCCGGGATTTGGGTCGCGGTTCTTGTTTGTGGATCGCTGTGATCGTC
HKR078811 ARe97A11 pKA1U5 NM_021009.4  
GAGTTCCGTCGCAGCCGGGATTTGGGTCGCAGTTCTTGTTTGTGGATTGCTGTGATCGTC
HKR082497 ARf06E01 pKA1U5 NM_021009.4  
GAGTTCCGTCGCAGCCGGGATTTGGGTCGCAGTTCTTGTTTGTGGATTGCTGTGATCGTC
HKR172855 ARi32C07 pGCAP10 NM_021009.4  
GTAGTTCCGTCGCAGCCGGGATTTGGGTCGCAGTTCTTGTTTGTGGATTGCTGTGATCGT
HKR203276 ARiS008D04 pGCAP10 NM_021009.4  
TGAGTTCCGTCGCAGCCGGGATTTGGGTCGCAGTTCTTGTTTGTGGATTGCTGTGATCGT
HKR209435 ARiS023J19 pGCAP10 NM_021009.4  
GAGTTCCGTCGCAGCCGGGATTTGGGTCGCGGTTCTTGTTTGTGGATCGCTGTGATCGTC
HKR334956 RBb37G12 pGCAP1 NM_021009.4  
GAGTTCCGTCGCAGCCGGGATTTGGGTCGCGGTTCTTGTTTGTGGATCGCTGTGATCGTC
HKR340854 RBb52C06 pGCAP1 NM_021009.4  
AGTTTCCGCTCGCAGCCGGGCATTTGGGTCGCGGATTCTTGATTTGNTGGATCGCNTGTG
HKR367607 RBd19A07 pGCAP10 NM_021009.4  
CGGCCGGCCGATGAGGGGCGGTTGGCTTTGTTGGGTGAGCTTGTTTGTGTCCCTGTGGGT
HKR382054 RBd55C06 pGCAP10 NM_021009.4  
GAGTTCCGTCGCAGCCGGGATTTGGGTCGCGGTTCTTGTTTNNGNNNCGCTGTGATCGTC
HKR405288 RBdS013D16 pGCAP10 NM_021009.4  
GAGTTCCGTCGCAGCCNGNATTTGGGTCGCGGTTCTTGTTTGTGGATCGCTGTGATCGTC
HKR420691 RBdS051M03 pGCAP10 NM_021009.4  
GAGTTCCGTCGCAGCCGGGATTTGGGTCGCGGTTCTTGTTTGTGGATCGCTGTGATCGTC
HKR432527 RBdS081F07 pGCAP10 NM_021009.4  
GAGTTCCGTCGCAGCCGGGATTTGGGTCGCGGTTCTTGTTTGTGGATCGCTGTGATCNTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.17

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl