Prev. | NRCD Clone U | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00171

HP ID(1) HP00171
Gene ID(2) 7381
Gene Symbol finder UQCRB
Protein Name ubiquinol-cytochrome c reductase binding protein
RefSeq NM_006294.3
Length of RefSeq (bp) 4433
Chromosome 8q22
Reference DDBJ accession
UniGene Hs.131255

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe35G07 pKA1U5 GCTTTCTGGTCAAAATGGCTGGTAAGCAGGCCGCTTTCAGCATCAGGCAAGTGGCTGGAT
ARe61H11 pKA1U5 GCTTTCTGGTCAAAATGGCTGGTAAGCAGGCCCCCTTTNACATCAGGCAAGTGGCTGGAT
ARe84H06 pKA1U5 GCTTTCTGGTCAAAATGGCTGGTAAGCAGGCCGTTTCAGCATCAGGCAAGTGGCTGGATG
ARi04E11 pGCAP10 GGAAGGCAACGCTTCTCTTTCTGGTCAAAATGGCTGGTAAGCAGGCCGTTTCAGCATCAG
ARi34A06 pGCAP10 GCTTTTTCTGGTCAAAATGGCTGGTAAGCAGGCCGTTTCAGCATCAGGCAAGTGGCTGGA
ARi43C03 pGCAP10 GTCTTTCTGGTCAAAATGGCTGGTAAGCAGGCCGTTTCAGCATCAGGCAAGTGGCTGGAT
ARi60A08 pGCAP10 GCTCTTTCTGGTCAAAATGGCTGGTAAGCAGGCCGTTTCAGCATCAGGCAAGTGGCTGGA
ARiS020F22 pGCAP10 GTTTCTGGTCAAAATGGCTGGTAAGCAGGCCGTTTCAGCATCAGGCAAGTGGCTGGATGG
ARiS122F09 pGCAP10 GCTCTTTCTGGTCAAAATGGCTGGTAAGCAGGCCGTTTCAGCATCAGGCAAGTGGCTGGA
ARiS122F17 pGCAP10 TTTTCTGGTCAAAATGGCTGGTAAGCAGGCCGTTTCAGCATCAGGCAAGTGGCTGGATGG
RBb25H06 pGCAP1 GGTCAAATGGCTGGTAAGCAGGCCGTTTCAGCATCAGGCAAGTGGCTGGATGGTATTCGA
RBb55A12 pGCAP1 GCTGGTCAAATGGCTGGTAAGCAGGCCGTTTCAGCATCAGGCAAGTGGCTGGATGGTATT
RBb71E11 pGCAP1 CGTTCTCTTTCTGGTCAAAATGGCTGGTAAGCAGGCCGTTTCAGCATCAGGCAAGTGGCT
RBd05D09 pGCAP10 GTCTCTTTCTGGTCAAAATGGCTGGTAAGCAGGCCGTTTCAGCATCAGGCAAGTGGCTGG
RBdS013L14 pGCAP10 GAGAAGGCAACGCTTCTCTTTCTGGTCAAAATGGCTGGTAAGCAGGCCGTTTCAGCATCA
RBdS022J21 pGCAP10 GTTTCTGGTCAAAATGGCTGGTAAGCAGGCCGTTTCAGCATCAGGCAAGTGGCTGGATGG
RBdS070B03 pGCAP10 GACCCAGAAGGCAACGCTTCTCTTTCTGGTCAAAATGGCTGGTAAGCAGGCCGTTTCAGC
RBdS075I14 pGCAP10 GAGAAGGCAACGCTTCTCTTTCTGGTCAAAATGGCTGGTAAGCAGGCCGTTTCAGCATCA
RBdS081G20 pGCAP10 GGGTCAAAATGGCTGGTAAGCAGGCCGTTTCAGCATCAGGCAAGTGGCTGGATGGTATTC
RBdS105B11 pGCAP10 GCTTTCTGGTCAAAATGGCTGGTAAGCAGGCCGTTTCAGCATCAGGAAAATTTCTACCTT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl