Prev. |  KEGG KO K00417 > 

RIKEN DNA Bank Human Resource - UQCRB

Gene ID NCBI Gene 7381 |  KEGG hsa:7381
Gene Symbol UQCRB
Protein Name ubiquinol-cytochrome c reductase binding protein
Synonyms MC3DN3|QCR7|QP-C|QPC|UQBC|UQBP|UQCR6|UQPC
Ortholog resources KEGG ortholog (KEGG orthology K00417) in the DNA Bank
Featured content Parkinson disease - human
Featured content Huntington disease - human
Featured content Alzheimer disease - human
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY086658 IRAL016K18 pDNR-LIB BC005230 NM_006294

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE096414 M01C041A14 pDONR221 MGC10-B07 BC005230 NM_006294  
HGE096462 M01C041C14 pDONR221 MGC10-B07 BC005230 NM_006294  
HGE096510 M01C041E14 pDONR221 MGC10-B07 BC005230 NM_006294  
HGE096558 M01C041G14 pDONR221 MGC10-B07 BC005230 NM_006294  
HGE096606 M01C041I14 pDONR221 MGC10-B07 BC005230 NM_006294  
HGE096654 M01C041K14 pDONR221 MGC10-B07 BC005230 NM_006294  
HGE096702 M01C041M14 pDONR221 MGC10-B07 BC005230 NM_006294  
HGE096750 M01C041O14 pDONR221 MGC10-B07 BC005230 NM_006294  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE012676 W01A031L12 pENTR-TOPO IRAL016K18 BC005230 NM_006294  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR054151 ARe35G07 pKA1U5 NM_006294.3  
GCTTTCTGGTCAAAATGGCTGGTAAGCAGGCCGCTTTCAGCATCAGGCAAGTGGCTGGAT
HKR064579 ARe61H11 pKA1U5 NM_006294.3  
GCTTTCTGGTCAAAATGGCTGGTAAGCAGGCCCCCTTTNACATCAGGCAAGTGGCTGGAT
HKR073774 ARe84H06 pKA1U5 NM_006294.3  
GCTTTCTGGTCAAAATGGCTGGTAAGCAGGCCGTTTCAGCATCAGGCAAGTGGCTGGATG
HKR161707 ARi04E11 pGCAP10 NM_006294.3  
GGAAGGCAACGCTTCTCTTTCTGGTCAAAATGGCTGGTAAGCAGGCCGTTTCAGCATCAG
HKR173606 ARi34A06 pGCAP10 NM_006294.3  
GCTTTTTCTGGTCAAAATGGCTGGTAAGCAGGCCGTTTCAGCATCAGGCAAGTGGCTGGA
HKR177251 ARi43C03 pGCAP10 NM_006294.3  
GTCTTTCTGGTCAAAATGGCTGGTAAGCAGGCCGTTTCAGCATCAGGCAAGTGGCTGGAT
HKR184008 ARi60A08 pGCAP10 NM_006294.3  
GCTCTTTCTGGTCAAAATGGCTGGTAAGCAGGCCGTTTCAGCATCAGGCAAGTGGCTGGA
HKR208142 ARiS020F22 pGCAP10 NM_006294.3  
GTTTCTGGTCAAAATGGCTGGTAAGCAGGCCGTTTCAGCATCAGGCAAGTGGCTGGATGG
HKR248929 ARiS122F09 pGCAP10 NM_006294.3  
GCTCTTTCTGGTCAAAATGGCTGGTAAGCAGGCCGTTTCAGCATCAGGCAAGTGGCTGGA
HKR248937 ARiS122F17 pGCAP10 NM_006294.3  
TTTTCTGGTCAAAATGGCTGGTAAGCAGGCCGTTTCAGCATCAGGCAAGTGGCTGGATGG
HKR330174 RBb25H06 pGCAP1 NM_006294.3  
GGTCAAATGGCTGGTAAGCAGGCCGTTTCAGCATCAGGCAAGTGGCTGGATGGTATTCGA
HKR342012 RBb55A12 pGCAP1 NM_006294.3  
GCTGGTCAAATGGCTGGTAAGCAGGCCGTTTCAGCATCAGGCAAGTGGCTGGATGGTATT
HKR348507 RBb71E11 pGCAP1 NM_006294.3  
CGTTCTCTTTCTGGTCAAAATGGCTGGTAAGCAGGCCGTTTCAGCATCAGGCAAGTGGCT
HKR362081 RBd05D09 pGCAP10 NM_006294.3  
GTCTCTTTCTGGTCAAAATGGCTGGTAAGCAGGCCGTTTCAGCATCAGGCAAGTGGCTGG
HKR405478 RBdS013L14 pGCAP10 NM_006294.3  
GAGAAGGCAACGCTTCTCTTTCTGGTCAAAATGGCTGGTAAGCAGGCCGTTTCAGCATCA
HKR409037 RBdS022J21 pGCAP10 NM_006294.3  
GTTTCTGGTCAAAATGGCTGGTAAGCAGGCCGTTTCAGCATCAGGCAAGTGGCTGGATGG
HKR428027 RBdS070B03 pGCAP10 NM_006294.3  
GACCCAGAAGGCAACGCTTCTCTTTCTGGTCAAAATGGCTGGTAAGCAGGCCGTTTCAGC
HKR430206 RBdS075I14 pGCAP10 NM_006294.3  
GAGAAGGCAACGCTTCTCTTTCTGGTCAAAATGGCTGGTAAGCAGGCCGTTTCAGCATCA
HKR432564 RBdS081G20 pGCAP10 NM_006294.3  
GGGTCAAAATGGCTGGTAAGCAGGCCGTTTCAGCATCAGGCAAGTGGCTGGATGGTATTC
HKR442035 RBdS105B11 pGCAP10 NM_006294.3  
GCTTTCTGGTCAAAATGGCTGGTAAGCAGGCCGTTTCAGCATCAGGAAAATTTCTACCTT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.05.17

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_190501.pl