Prev. | NRCD Clone W | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00169

HP ID(1) HP00169
Gene ID(2) 51729
Gene Symbol finder WBP11
Protein Name WW domain binding protein 11
RefSeq NM_016312.2
Length of RefSeq (bp) 2690
Chromosome 12p12.3
Reference DDBJ accession
UniGene Hs.655138

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi10H01 pGCAP10 GGTTTCGCGATGGCGGGAGCTGACGGGTTGACCGAGAGACCCAGTTGACGGCCTTTACGA
RBb50E09 pGCAP1 GAGAGGAATGGGAAATGACGCTGAGGAGTGCGGAGGGGCGCGAGGNTTTCAAGATGGCGG
RBb50F08 pGCAP1 GAGAGGAATGGGAAATGACGTGAGGAGTGCGGAGGGGCGCGAGGTTTCAAGATGGCGGTA
RBd78F05 pGCAP10 GAGGTTTCAAGATGGCGGTAGCTGAGGGGTTGACCGAGAGACCCAGTTGAAGGCCTTTAC
RBdS014I21 pGCAP10 GGAGGTTTCAAGATGGCGGTAGCTGAGGGGTTGACCGAGAGACCCAGTTGAAGGCCTTTA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl