Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS014I21

Clone ID RBdS014I21
HP ID HP00169
Gene ID 51729
Gene Symbol WBP11
Protein Name WW domain binding protein 11
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_016312.2
Length of RefSeq (bp) 2690
Chromosome 12p12.3
Reference DDBJ accession
UniGene Hs.655138
5'-terminal sequence GGAGGTTTCAAGATGGCGGTAGCTGAGGGGTTGACCGAGAGACCCAGTTGAAGGCCTTTA
2011.08.28