Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00165

HP ID(1) HP00165
Gene ID(2) 7295
Gene Symbol finder TXN
Protein Name thioredoxin
RefSeq NM_003329.2
Length of RefSeq (bp) 508
Chromosome 9q31
Reference DDBJ accession
UniGene Hs.435136

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe65D10 pKA1U5 GGTGCCAGTNNATAAAGGGAGAGAGCAAGCAGCGAGTCTNGAAGCTCTGTTTNGGTGCTN
ARe67F04 pKA1U5 GGTGCCAGTTTATAAAGGGAGAGAGCAAGCAGCGAGTCTTGAAGCTCTGTTTGGTGCTTT
ARe75E09 pKA1U5 GGCAGCGACGGGCGCGGAGGTCCGGCCGGGCGCGCGCGCCCCCGCCACACGCACGCCGGG
ARi14F01 pGCAP10 GACAGCCGCTCGTCAGACTCCAGCAGCCAAGATGGTGAAGCAGATCGAGAGCAAGACTGC
ARi19H03 pGCAP10 GATAAAGGGAGAGAGCAAGCAGCGAGTCTTGAAGCTCTGTTTGGTGCTTTGGATCCATTT
ARi44G09 pGCAP10 GGAAGCTCTGTTTGGTGCTTTGGATCCATTTCCATCGGTCCTTACAGCCGCTCGTCAGAC
ARi70C02 pGCAP10 GGAAGCTCTGTTTGGTGCTTTGGATCCATTTCCATCGGTCCTTACAGCCGCTCGTCAGAC
ARiS045P20 pGCAP10 GGAAGCTCTGTTTGGTGCTTTGGATCCATTTCCATCGGTCCTTACAGCCGCTCGTCAGAC
ARiS118E21 pGCAP10 GGAAGCTCTGTTTGGTGCTTTGGATCCATTTCCATCGGTCCTTACAGCCGCTCGTCAGAC
RBb04G03 pKA1U5 GACACGCACGCCGGGCGTGCCAGTTTATAAAGGNAGTNNTAGCAAGCAGCGAGTCTTGAA
RBb35F09 pGCAP1 AAATGTGGAGCCCCGCCCCGATCCCGGCTCGCAGGCTCCAGGGGCGGGGCGTGGCCGGGG
RBb36C03 pGCAP1 TGGCCCCCGCCACACGGCACGCCCGGGGCGTGCCAGTTTATAAAGGGAGAGAGCAAGCAG
RBb42D05 pGCAP1 GGCCCCCGCCACACGTCACGCCGGGCGTGCCAGNTTTATCCCCTNTGAGAGCAAGCAGCG
RBb71A05 pGCAP1 GGCGCGCCCCCGCCACACGCACGCCGGGCGTGCCAGTTTATAAAGGGAGAGAGCAAGCAG
RBd03E12 pGCAP10 GACGCCGGGCGTGCCAGTTTATAAAGGGAGAGAGCAAGCAGCGAGTCTTGAAGCTCTGTT
RBd20C08 pGCAP10 GGACGGGCGCGGAGGTCCGGCCGGGCGCGCGCGCCCCCGCCACACGCACGCCGGGCGTGC
RBd52B05 pGCAP10 GGCGCGCCCCCGCCACACGCACGCCGGGCGTGCCAGTTTATAAAGGGAGAGAGCAAGCAG
RBd52C06 pGCAP10 TGGGTCGCCCGCCCACGCCGAGGGCGGGGGCGCCACTTTATTGAGGTCCAGAGCTGGCCG
RBdS007N08 pGCAP10 GATTTTTCCATCGGTCCTTACAGCCGCTCGTCAGACTCCAGCAGCCAAGATGGTGAAGCA
RBdS022L03 pGCAP10 GATAAAGGGAGAGAGCAAGCAGCGAGTCTTGAAGCTCTGTTTGGTGCTTTGGATCCATTT
RBdS070F17 pGCAP10 GGAAGCTCTGTTTGGTGCTTTGGATCCATTTCCATCGGTCCTTACAGCCGCTCGTCAGAC
RBdS105F08 pGCAP10 GGAAGCTCTGTTTGGTGCTTTGGATCCATTTCCATCGGTCCTTACAGCCGCTCGTCAGAC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl