Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00150

HP ID(1) HP00150
Gene ID(2) 7265
Gene Symbol finder TTC1
Protein Name tetratricopeptide repeat domain 1
RefSeq NM_003314.1
Length of RefSeq (bp) 1407
Chromosome 5q32-q33.2
Reference DDBJ accession
UniGene Hs.519718

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe26B01 pKA1U5 GAAGAAGGTGGAGACCGGAGAAGCTGTGAGGTTCTTTAGCGTCACCTCCCTCACTGGGCA
ARi37C05 pGCAP10 GAGGAGCTCTCAGAGGCTAAGAAGGTGGAGACCGGAGAAGCTGTGAGGTTCTTTAGCGTC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl