Prev. | 

RIKEN DNA Bank Human Resource - TTC1

Gene ID NCBI Gene 7265 |  KEGG hsa:7265
Gene Symbol TTC1
Protein Name tetratricopeptide repeat domain 1
Synonyms TPR1
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR050425 ARe26B01 pKA1U5 NM_003314.1 Full done
GAAGAAGGTGGAGACCGGAGAAGCTGTGAGGTTCTTTAGCGTCACCTCCCTCACTGGGCA
HKR174853 ARi37C05 pGCAP10 NM_003314.1  
GAGGAGCTCTCAGAGGCTAAGAAGGTGGAGACCGGAGAAGCTGTGAGGTTCTTTAGCGTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl