Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00147

HP ID(1) HP00147
Gene ID(2) 7086
Gene Symbol finder TKT
Protein Name transketolase
RefSeq NM_001064.2
Length of RefSeq (bp) 2117
Chromosome 3p14.3
Reference DDBJ accession
UniGene Hs.89643

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe17C11 pKA1U5 GCTCGGCAGCCGCCTGTCGCCGCGGGAGCAGCCGCTATCTCTGTGTGTCCGCGATGTGCG
ARe20F05 pKA1U5 GCTCGGCAGCCGCCTGTCGCCGCGGGAGCAGCCGCTATCTCTGTGTGTCCGCGTGTGCGC
ARe24B08 pKA1U5 TGGGCTATCTCTGTGTGTCCGCGTGTGCGCCCGGTCCCCGCCTGCCGCACCATGGAGAGC
ARe31F08 pKA1U5 GCTCTCGGCAGCCGCCTGTCGCCGCGGGAGCAGCCGCTATCTCTGTGTGTCCGCGTGTGC
ARe71E11 pKA1U5 GCTCGGCAGCCGCCTGTCGCCGCGGGAGCAGCCGCTATCTCTGTGTGTCCGCGTGTGCGC
ARe72G04 pKA1U5 GCTCGGCAGCCGCCTGTCGCCGCGGGAGCAGCCGCTATCTCTGTGTGTCCGCGTGTGCGC
ARe84E01 pKA1U5 GCTCGGCAGCCGCCTGTCGCCGCGGGAGCAGCCGCTATCTCTGTGTGTCCGCGTGTGCGC
ARe85E03 pKA1U5 GCTCGGCAGCCGCCTGTCGCCGCGGGAGCAGCCGCTATCTCTGTGTGTCCGCGTGTGCGC
ARe85G09 pKA1U5 GCTCGGCAGCCGCCTGTCGCCGCGGGAGCAGCCGCTATCTCTGTGTGTCCGCGTGTGCGC
ARi12G05 pGCAP10 GCTCGGCAGCCGCCTGTCGGCGCGGGAGCAGCCGCTATCTCTGTGTGTCCGCGTGTGCGC
ARi35H12 pGCAP10 GCTCGGCAGCCGCCTGTCGCCGCGGGAGCAGCCGCTATCTCTGTGTGTCCGCGTGTGCGC
ARi42C03 pGCAP10 GCTCGGCAGCCGCCTGTCGCCGCGGGAGCAGCCGCTATCTCTGTGTGTCCGCGTGTGCGC
ARi54A08 pGCAP10 GCTCGGCAGCCGCCTGTCGCCGCGGGAGCAGCCGCTATCTCTGTGTGTCCGCGTGTGCGC
RBb19G06 pKA1U5 GCTCGGCAGCCGCCTGTCGCCGCGGGAGCAGCCNCTTATCTCTGTGTGTCCGCGTGTGCG
RBd10A08 pGCAP10 GGACTTAACGCGCCCCCGCCCCGCGCCCGGCCTCGGCAGCCGCCTGTCGCCGCGGGAGCA
RBd24F07 pGCAP10 GGACTTAACGCGCCCCCGCCCCGCGCCCGGCCTCGGCAGCCGCCTGTCGCCGCGGGAGCA
RBd25F06 pGCAP10 GCTCGGCAGCCGCCTGTCGCCGCGGGAGCAGCCGCTATCTCTGTGTGTCCGCGTGTGCGC
RBd67B10 pGCAP10 GGGCCTCGGCAGCCGCCTGTCGCCGCGGGAGCAGCCGCTATCTCTGTGTGTCCGCGTGTG
RBd97B03 pGCAP10 CGGCCGGCCGATTGCTCGGCAGCCGCCTGTCGCCGCGGGAGCAGCCGCTATCTCTGTGTG
RBdS104A12 pGCAP10 GGCCGCGGGAGCAGCCGCTATCTCTGTGTGTCCGCGTGTGCGCCCGGTCCCCGCCTGCCG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl