Prev. |  KEGG KO K00615 > 

RIKEN DNA Bank Human Resource - TKT

Gene ID NCBI Gene 7086 |  KEGG hsa:7086
Gene Symbol TKT
Protein Name transketolase
Synonyms HEL-S-48|HEL107|SDDHD|TK|TKT1
Ortholog resource in our bank

  TKT

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX004876 IRAK012D04 pCMV-SPORT6 BC008615 NM_001064 Partial
HGY081541 IRAL003O05 pOTB7 BC024026 NM_001064 Partial
HGY082114 IRAL005E18 pOTB7 BC002433 NM_001064 Full/var
HGY090763 IRAL026P03 pOTB7 BC009970 NM_001064 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE099214 M01C048A14 pDONR221 MGC13-F07 BC009970 ENST00000296289  
HGE099262 M01C048C14 pDONR221 MGC13-F07 BC009970 ENST00000296289  
HGE099310 M01C048E14 pDONR221 MGC13-F07 BC009970 ENST00000296289  
HGE099358 M01C048G14 pDONR221 MGC13-F07 BC009970 ENST00000296289  
HGE099406 M01C048I14 pDONR221 MGC13-F07 BC009970 ENST00000296289  
HGE099454 M01C048K14 pDONR221 MGC13-F07 BC009970 ENST00000296289  
HGE099502 M01C048M14 pDONR221 MGC13-F07 BC009970 ENST00000296289  
HGE099550 M01C048O14 pDONR221 MGC13-F07 BC009970 ENST00000296289  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR046859 ARe17C11 pKA1U5 NM_001064.2  
GCTCGGCAGCCGCCTGTCGCCGCGGGAGCAGCCGCTATCTCTGTGTGTCCGCGATGTGCG
HKR048125 ARe20F05 pKA1U5 NM_001064.2  
GCTCGGCAGCCGCCTGTCGCCGCGGGAGCAGCCGCTATCTCTGTGTGTCCGCGTGTGCGC
HKR049632 ARe24B08 pKA1U5 NM_001064.2  
TGGGCTATCTCTGTGTGTCCGCGTGTGCGCCCGGTCCCCGCCTGCCGCACCATGGAGAGC
HKR052528 ARe31F08 pKA1U5 NM_001064.2  
GCTCTCGGCAGCCGCCTGTCGCCGCGGGAGCAGCCGCTATCTCTGTGTGTCCGCGTGTGC
HKR068507 ARe71E11 pKA1U5 NM_001064.2  
GCTCGGCAGCCGCCTGTCGCCGCGGGAGCAGCCGCTATCTCTGTGTGTCCGCGTGTGCGC
HKR068948 ARe72G04 pKA1U5 NM_001064.2  
GCTCGGCAGCCGCCTGTCGCCGCGGGAGCAGCCGCTATCTCTGTGTGTCCGCGTGTGCGC
HKR073697 ARe84E01 pKA1U5 NM_001064.2  
GCTCGGCAGCCGCCTGTCGCCGCGGGAGCAGCCGCTATCTCTGTGTGTCCGCGTGTGCGC
HKR074099 ARe85E03 pKA1U5 NM_001064.2  
GCTCGGCAGCCGCCTGTCGCCGCGGGAGCAGCCGCTATCTCTGTGTGTCCGCGTGTGCGC
HKR074153 ARe85G09 pKA1U5 NM_001064.2  
GCTCGGCAGCCGCCTGTCGCCGCGGGAGCAGCCGCTATCTCTGTGTGTCCGCGTGTGCGC
HKR164949 ARi12G05 pGCAP10 NM_001064.2  
GCTCGGCAGCCGCCTGTCGGCGCGGGAGCAGCCGCTATCTCTGTGTGTCCGCGTGTGCGC
HKR174180 ARi35H12 pGCAP10 NM_001064.2  
GCTCGGCAGCCGCCTGTCGCCGCGGGAGCAGCCGCTATCTCTGTGTGTCCGCGTGTGCGC
HKR176851 ARi42C03 pGCAP10 NM_001064.2  
GCTCGGCAGCCGCCTGTCGCCGCGGGAGCAGCCGCTATCTCTGTGTGTCCGCGTGTGCGC
HKR181608 ARi54A08 pGCAP10 NM_001064.2  
GCTCGGCAGCCGCCTGTCGCCGCGGGAGCAGCCGCTATCTCTGTGTGTCCGCGTGTGCGC
HKR327750 RBb19G06 pKA1U5 NM_001064.2  
GCTCGGCAGCCGCCTGTCGCCGCGGGAGCAGCCNCTTATCTCTGTGTGTCCGCGTGTGCG
HKR364008 RBd10A08 pGCAP10 NM_001064.2  
GGACTTAACGCGCCCCCGCCCCGCGCCCGGCCTCGGCAGCCGCCTGTCGCCGCGGGAGCA
HKR369727 RBd24F07 pGCAP10 NM_001064.2  
GGACTTAACGCGCCCCCGCCCCGCGCCCGGCCTCGGCAGCCGCCTGTCGCCGCGGGAGCA
HKR370126 RBd25F06 pGCAP10 NM_001064.2  
GCTCGGCAGCCGCCTGTCGCCGCGGGAGCAGCCGCTATCTCTGTGTGTCCGCGTGTGCGC
HKR386834 RBd67B10 pGCAP10 NM_001064.2  
GGGCCTCGGCAGCCGCCTGTCGCCGCGGGAGCAGCCGCTATCTCTGTGTGTCCGCGTGTG
HKR398827 RBd97B03 pGCAP10 NM_001064.2  
CGGCCGGCCGATTGCTCGGCAGCCGCCTGTCGCCGCGGGAGCAGCCGCTATCTCTGTGTG
HKR441612 RBdS104A12 pGCAP10 NM_001064.2  
GGCCGCGGGAGCAGCCGCTATCTCTGTGTGTCCGCGTGTGCGCCCGGTCCCCGCCTGCCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl