Prev. | NRCD Clone N | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00137

HP ID(1) HP00137
Gene ID(2) 4837
Gene Symbol finder NNMT
Protein Name nicotinamide N-methyltransferase
RefSeq NM_006169.2
Length of RefSeq (bp) 1579
Chromosome 11q23.1
Reference DDBJ accession
UniGene Hs.503911

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe46E10 pKA1U5 GATTTCCTAGAACAGCCAGAACATTTGTGGTCTATTTCTCTGTTAGTGTTTAACCAACCA
ARe50E11 pKA1U5 GCCTATTTCTCTGTTTAGCTGGTTTAACCAACCANTCCTGATTCTAAAAGAAGGGCTGAA
ARiS191P19 pGCAP10 TAGAACAGCCAGAACATTTGTGGTCTATTTCTCTGTTAGTGTTTAACCAACCATCTGTTC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl