Prev. |  KEGG KO K00541 > 

RIKEN DNA Bank Human Resource - NNMT

Gene ID NCBI Gene 4837 |  KEGG hsa:4837
Gene Symbol NNMT
Protein Name nicotinamide N-methyltransferase
Synonyms -
Ortholog resource in our bank

  NNMT

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY082593 IRAL006I01 pOTB7 BC000234 NM_006169 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR058506 ARe46E10 pKA1U5 NM_006169.2  
GATTTCCTAGAACAGCCAGAACATTTGTGGTCTATTTCTCTGTTAGTGTTTAACCAACCA
HKR060107 ARe50E11 pKA1U5 NM_006169.2  
GCCTATTTCTCTGTTTAGCTGGTTTAACCAACCANTCCTGATTCTAAAAGAAGGGCTGAA
HKR276779 ARiS191P19 pGCAP10 NM_006169.2  
TAGAACAGCCAGAACATTTGTGGTCTATTTCTCTGTTAGTGTTTAACCAACCATCTGTTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl