Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00134

HP ID(1) HP00134
Gene ID(2) 7168
Gene Symbol finder TPM1
Protein Name tropomyosin 1 (alpha)
RefSeq NM_000366.5
Length of RefSeq (bp) 1294
Chromosome 15q22.1
Reference DDBJ accession
UniGene Hs.133892

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe06A12 pKA1U5 GGCTCGCACTCCCGCTCCTCCGCCCGACCGCGCGCTCGCCCCGCCGCTCCTGCTGCAGCC
ARe08E01 pKA1U5 GGTCTTGAGGAATGCGGTCGCCCCCTTGGGAAAGTACATATCTGGGAGAAGCAGGCGGCT
ARe09A01 pKA1U5 GGCACTCCCGCTCCTCCGCCCGACCGCGCGCTCGCCCCGCCGCTCCTGCTGCAGCCCCAG
ARe16B08 pKA1U5 GGCTCGCACTCCCGCTCCTCCGCCCGACCGCGCGCTCGCCCCGCCGCTCCTGCTGCAGCC
ARe20B06 pKA1U5 GGCACTCCCGCTCCTCCGCCCGACCGCGCGCTCGCCCCGCCGCTCCTGCTGCAGCCCCAG
ARe23F02 pKA1U5 GGCACTCCCGCTCCTCCGCCCGACCGCGCGCTCGCCCCGCCGCTCCTGCTGCAGCCCCAG
ARe27B11 pKA1U5 GGCTCGCACTCCCGCTCCTCCGCCCGACCGCGCGCTCGCCCCGCCGCTCCTGCATGCAGC
ARe28C03 pKA1U5 GGCTCGCACTCCCGCTCCTCCGCCCGACCGCGCGCTCGCCCCGCCGCTCCTGCTGCAGCC
ARe44C09 pKA1U5 GGCTCGCACTCCCGCTCCTCCGCCCGACCGCGCGCTCGCCCCGCCGCTCCTGCTGCAGCC
ARe52G08 pKA1U5 GTCGCACTCCCGCTCCTCCGCCCGACCGCGCGCTCNTCCCGCCGCTCCTGCTGCAGCCCC
ARe52H05 pKA1U5 GGCTCGCACTCCCGCTCCTCCGCCCGACCGCGCCCTTCNNACCCGCCGCTNCTGCTGCAG
ARe55F04 pKA1U5 AGNTGGCACTCCCGCTCCTCCGCCCGACCGCGCGCCCTTNACCGCCGCTCCTGCTGCAGC
ARe57C12 pKA1U5 GGCTCGCACTCCCGCTCCTCCGCCCGACCGCGCGCTCGCCCCGCCGCTCCTGCTGCAGCC
ARe66E09 pKA1U5 GGCACTCCCGCTCCTCCGCCCGACCGCGCGCTCGCCCCGCCGCTCCTGCTGCAGCCCCAG
ARe71A09 pKA1U5 GCGCACTCCCGCTCCTCCGCCCGACCGCGCGCTCGCCCCGCCGCTCCTGCTGCAGCCCCA
ARe71G11 pKA1U5 ATCCTGGTCGCACTCCCGCTCCTCCGCCCGACCGCGCGCTCGCCCCGCCGCTCCTGCTGC
ARe72B10 pKA1U5 GGCTCGCACTCCCGCTCCTCCGCCCGACCGCGCGCTCGCCCCGCCGCTCCTGCTGCAGCC
ARe72D02 pKA1U5 GCGCACTCCCGCTCCTCCGCCCGACCGCGCGCTCGCCCCGCCGCTCCTGCTGCAGCCCCA
ARe73F04 pKA1U5 GGCACTCCCGCTCCTCCGCCCGACCGCGCGCTCCCCTTNNCGCTCCTGCTGCAGCCCCAG
ARe75F02 pKA1U5 GGCTCGCACTCCCGCTCCTCCGCCCGACCGCGCCNCTTTTACCCGCCGCTCCTGCTGCAG
ARe76H12 pKA1U5 GGCTCGCACTCCCGCTCCTCCGCCCGACCGCCCCTTTAANGGNGCCGCTCCTGCTGCAGC
ARe77C04 pKA1U5 GGCTCGCACATCCCGCTCCTCCGCCCGAACCGCGCNCTTNGCCCCGCCGCTCCTGCTGCA
ARe83B12 pKA1U5 GGCTCGCACTCCCGCTCCTCCGCCCGACCGCGCGCTCGCCCCGCCGCTCCTGCTGCAGCC
ARe84E05 pKA1U5 ATCCTGGGCACTCCCGCTCCTCCGCCCGACCGCGCGCTCGCCCCGCCGCTCCTGCTGCAG
ARe86E12 pKA1U5 GGCACTCCCGCTCCTCCGCCCGACCGCGCGCTCGCCCCGCCGCTCCTGCTGCAGCCCCAG
ARe86G02 pKA1U5 TGGCACTCCCGCTCCTCCGCCCGACCGCGCGCTCGCCCCGCCGCTCCTGCTGCAGCCCCA
ARe86H08 pKA1U5 GGCACTCCCGCTCCTCCGCCCGACCGCGCGCTCGCCCCGCCGCTCCTGCTGCAGCCCCAG
ARe90F03 pKA1U5 GGCTCGCACTCCCGCTCCTCCGCCCGACCGCGCGCTCGCCCCGCCGCTCCTGCTGCAGCC
ARe92A03 pKA1U5 GGCACTCCCGCTCCTCCGCCCGACCGCGCGCTCGCCCCGCCGCTCCTGCTGCAGCCCCAG
ARe95E12 pKA1U5 TGGCTCGCACTCCCGCTCCTCCGCCCGACCGCGCGCTCGCCCCGCCGCTCCTGCTGCAGC
ARe98C08 pKA1U5 GGCACTCCCGCTCCTCCGCCCGACCGCGCGCTCGCCCCGCCGCTCCTGCTGCAGCCCCAG
ARe98E07 pKA1U5 GGCTCGCACTCCCGCTCCTCCGCCCGACCGCGCGCTCGCCCCGCCGCTCCTGCTGCAGCC
ARi11C02 pGCAP10 GGCACTCCCGCTCCTCCGCCCGACCGCGCGCTCGCCCCGCCGCTCCTGCTGCAGCCCCAG
ARi18H03 pGCAP10 GACTCCCGCTCCTCCGCCCGACCGCGCGCTCGCCCCGCCGCTCCTGCTGCAGCCCCAGGG
ARi19D02 pGCAP10 GGCACTCCCGCTCCTCCGCCCGACCGCGCGCTCGCCCCGCCGCTCCTGCTGCAGCCCCAG
ARi36G04 pGCAP10 GCGCACTCCCGCTCCTCCGCCCGACCGCGCGCTCGCCCCGCCGCTCCTGCTGCAGCCCCA
ARi44C05 pGCAP10 GCGCACTCCCGCTCCTCCGCCCGACCGCGCGCTCGCCCCGCCGCTCCTGCTGCAGCCCCA
ARi49F09 pGCAP10 GGGGAGAAGCAGGCGGCTCCGCGCTCGCACTCCCGCTCCTCCGCCCGACCGCGCGCTCGC
ARi52G01 pGCAP10 GCGCACTCCCGCTCCTCCGCCCGACCGCGCGCTCGCCCCGCCGCTCCTGCTGCAGCCCCA
ARi54F08 pGCAP10 GGCTCGCACTCCCGCTCCTCCGCCCGACCGCGCGCTCGCCCCGCCGCTCCTGCTGCAGCC
ARi59C12 pGCAP10 GGCACTCCCGCTCCTCCGCCCGACCGCGCGCTCGCCCCGCCGCTCCTGCTGCAGCCCCAG
ARi66E07 pGCAP10 GGCTCGCACTCCCGCTCCTCCGCCCGACCGCGCGCTCGCCCCGCCGCTCCTGCTGCAGCC
ARiS045D04 pGCAP10 NCGGCCGGCCGATGGCTCGCACTCCCGCTCCTCCGCCCGACCGCGCGCTCGCCCCGCCGC
ARiS049H04 pGCAP10 GGGCTGTCTTGAGGAATGCGGTCGCCCCCTTGGGAAAGTACATATCTGGGAGAAGCAGGC
ARiS049I13 pGCAP10 GGCACTCCCGCTCCTCCGCCCGACCGCGCGCTCGCCCCGCCGCTCCTGCTGCAGCCCCAG
ARiS055A18 pGCAP10 GGCACTCCCGCTCCTCCGCCCGACCGCGCGCTCGCCCCGCCGCTCCTGCTGCAGCCCCAG
ARiS055I08 pGCAP10 GATGCGGTCGCCCCCTTGGGAAAGTACATATCTGGGAGAAGCAGGCGGCTCCGCGCTCGC
ARiS087P03 pGCAP10
ARiS096L03 pGCAP10 GGAAGGAGCTGACCAGCCAGCTGACCCCTCACACTCACCTAGCCACCATGGACATCGCCA
ARiS096L04 pGCAP10 GGCTCGCACTCCCGCTCCTCCGCCCGACCGCGCGCTCGCCCCGCCGCTCCTGCTGCAGCC
ARiS161G01 pGCAP10 GATATCTGGGAGAAGCAGGCGGCTCCGCGCTCGCACTCCCGCTCCTCCGCCCGACCGCGC
ARiS191G10 pGCAP10 GGCACTCCCGCTCCTCCGCCCGACCGCGCGCTCGCCCCGCCGCTCCTGCTGCAGCCCCAG
ARiS191K09 pGCAP10 TCGCACTCCCGCTCCTCCGCCCGACCGCNCGCTCGCCCCGCCGCTCCTGCTGCAGCCCCA
RBb44A05 pGCAP1 GCCCCTTGGGAAAGTACATATCTGGGAGAAGCAGGCGGCTCCGCGCTCGCACTCCCGCTC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl