Prev. |  KEGG KO K10373 > 

RIKEN DNA Bank Human Resource - TPM1

Gene ID NCBI Gene 7168 |  KEGG hsa:7168
Gene Symbol TPM1
Protein Name tropomyosin 1
Synonyms C15orf13|CMD1Y|CMH3|HEL-S-265|HTM-alpha|LVNC9|TMSA
Ortholog resource in our bank

  TPM1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX039258 IRAK098C10 pCMV-SPORT6 BC050473 NM_001018008 Full
HGX046159 IRAK115G15 pCMV-SPORT6 BC053545 NM_001018008 Full
HGY084181 IRAL010H13 pOTB7 BC007433 NM_000366 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE098005 M01C045A05 pDONR221 MGC12-A03 BC007433 NM_000366  
HGE098053 M01C045C05 pDONR221 MGC12-A03 BC007433 NM_000366  
HGE098101 M01C045E05 pDONR221 MGC12-A03 BC007433 NM_000366  
HGE098149 M01C045G05 pDONR221 MGC12-A03 BC007433 NM_000366  
HGE098197 M01C045I05 pDONR221 MGC12-A03 BC007433 NM_000366  
HGE098245 M01C045K05 pDONR221 MGC12-A03 BC007433 NM_000366  
HGE098293 M01C045M05 pDONR221 MGC12-A03 BC007433 NM_000366  
HGE098341 M01C045O05 pDONR221 MGC12-A03 BC007433 NM_000366  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR042412 ARe06A12 pKA1U5 NM_000366.5  
GGCTCGCACTCCCGCTCCTCCGCCCGACCGCGCGCTCGCCCCGCCGCTCCTGCTGCAGCC
HKR043297 ARe08E01 pKA1U5 NM_000366.5  
GGTCTTGAGGAATGCGGTCGCCCCCTTGGGAAAGTACATATCTGGGAGAAGCAGGCGGCT
HKR043601 ARe09A01 pKA1U5 NM_000366.5  
GGCACTCCCGCTCCTCCGCCCGACCGCGCGCTCGCCCCGCCGCTCCTGCTGCAGCCCCAG
HKR046432 ARe16B08 pKA1U5 NM_000366.5  
GGCTCGCACTCCCGCTCCTCCGCCCGACCGCGCGCTCGCCCCGCCGCTCCTGCTGCAGCC
HKR048030 ARe20B06 pKA1U5 NM_000366.5  
GGCACTCCCGCTCCTCCGCCCGACCGCGCGCTCGCCCCGCCGCTCCTGCTGCAGCCCCAG
HKR049322 ARe23F02 pKA1U5 NM_000366.5  
GGCACTCCCGCTCCTCCGCCCGACCGCGCGCTCGCCCCGCCGCTCCTGCTGCAGCCCCAG
HKR050835 ARe27B11 pKA1U5 NM_000366.5  
GGCTCGCACTCCCGCTCCTCCGCCCGACCGCGCGCTCGCCCCGCCGCTCCTGCATGCAGC
HKR051251 ARe28C03 pKA1U5 NM_000366.5  
GGCTCGCACTCCCGCTCCTCCGCCCGACCGCGCGCTCGCCCCGCCGCTCCTGCTGCAGCC
HKR057657 ARe44C09 pKA1U5 NM_000366.5  
GGCTCGCACTCCCGCTCCTCCGCCCGACCGCGCGCTCGCCCCGCCGCTCCTGCTGCAGCC
HKR060952 ARe52G08 pKA1U5 NM_000366.5  
GTCGCACTCCCGCTCCTCCGCCCGACCGCGCGCTCNTCCCGCCGCTCCTGCTGCAGCCCC
HKR060973 ARe52H05 pKA1U5 NM_000366.5  
GGCTCGCACTCCCGCTCCTCCGCCCGACCGCGCCCTTCNNACCCGCCGCTNCTGCTGCAG
HKR062124 ARe55F04 pKA1U5 NM_000366.5  
AGNTGGCACTCCCGCTCCTCCGCCCGACCGCGCGCCCTTNACCGCCGCTCCTGCTGCAGC
HKR062860 ARe57C12 pKA1U5 NM_000366.5  
GGCTCGCACTCCCGCTCCTCCGCCCGACCGCGCGCTCGCCCCGCCGCTCCTGCTGCAGCC
HKR066505 ARe66E09 pKA1U5 NM_000366.5  
GGCACTCCCGCTCCTCCGCCCGACCGCGCGCTCGCCCCGCCGCTCCTGCTGCAGCCCCAG
HKR068409 ARe71A09 pKA1U5 NM_000366.5  
GCGCACTCCCGCTCCTCCGCCCGACCGCGCGCTCGCCCCGCCGCTCCTGCTGCAGCCCCA
HKR068555 ARe71G11 pKA1U5 NM_000366.5  
ATCCTGGTCGCACTCCCGCTCCTCCGCCCGACCGCGCGCTCGCCCCGCCGCTCCTGCTGC
HKR068834 ARe72B10 pKA1U5 NM_000366.5  
GGCTCGCACTCCCGCTCCTCCGCCCGACCGCGCGCTCGCCCCGCCGCTCCTGCTGCAGCC
HKR068874 ARe72D02 pKA1U5 NM_000366.5  
GCGCACTCCCGCTCCTCCGCCCGACCGCGCGCTCGCCCCGCCGCTCCTGCTGCAGCCCCA
HKR069324 ARe73F04 pKA1U5 NM_000366.5  
GGCACTCCCGCTCCTCCGCCCGACCGCGCGCTCCCCTTNNCGCTCCTGCTGCAGCCCCAG
HKR070122 ARe75F02 pKA1U5 NM_000366.5  
GGCTCGCACTCCCGCTCCTCCGCCCGACCGCGCCNCTTTTACCCGCCGCTCCTGCTGCAG
HKR070580 ARe76H12 pKA1U5 NM_000366.5  
GGCTCGCACTCCCGCTCCTCCGCCCGACCGCCCCTTTAANGGNGCCGCTCCTGCTGCAGC
HKR070852 ARe77C04 pKA1U5 NM_000366.5  
GGCTCGCACATCCCGCTCCTCCGCCCGAACCGCGCNCTTNGCCCCGCCGCTCCTGCTGCA
HKR073236 ARe83B12 pKA1U5 NM_000366.5  
GGCTCGCACTCCCGCTCCTCCGCCCGACCGCGCGCTCGCCCCGCCGCTCCTGCTGCAGCC
HKR073701 ARe84E05 pKA1U5 NM_000366.5  
ATCCTGGGCACTCCCGCTCCTCCGCCCGACCGCGCGCTCGCCCCGCCGCTCCTGCTGCAG
HKR074508 ARe86E12 pKA1U5 NM_000366.5  
GGCACTCCCGCTCCTCCGCCCGACCGCGCGCTCGCCCCGCCGCTCCTGCTGCAGCCCCAG
HKR074546 ARe86G02 pKA1U5 NM_000366.5  
TGGCACTCCCGCTCCTCCGCCCGACCGCGCGCTCGCCCCGCCGCTCCTGCTGCAGCCCCA
HKR074576 ARe86H08 pKA1U5 NM_000366.5  
GGCACTCCCGCTCCTCCGCCCGACCGCGCGCTCGCCCCGCCGCTCCTGCTGCAGCCCCAG
HKR076123 ARe90F03 pKA1U5 NM_000366.5  
GGCTCGCACTCCCGCTCCTCCGCCCGACCGCGCGCTCGCCCCGCCGCTCCTGCTGCAGCC
HKR076803 ARe92A03 pKA1U5 NM_000366.5  
GGCACTCCCGCTCCTCCGCCCGACCGCGCGCTCGCCCCGCCGCTCCTGCTGCAGCCCCAG
HKR078108 ARe95E12 pKA1U5 NM_000366.5  
TGGCTCGCACTCCCGCTCCTCCGCCCGACCGCGCGCTCGCCCCGCCGCTCCTGCTGCAGC
HKR079256 ARe98C08 pKA1U5 NM_000366.5  
GGCACTCCCGCTCCTCCGCCCGACCGCGCGCTCGCCCCGCCGCTCCTGCTGCAGCCCCAG
HKR079303 ARe98E07 pKA1U5 NM_000366.5  
GGCTCGCACTCCCGCTCCTCCGCCCGACCGCGCGCTCGCCCCGCCGCTCCTGCTGCAGCC
HKR164450 ARi11C02 pGCAP10 NM_000366.5  
GGCACTCCCGCTCCTCCGCCCGACCGCGCGCTCGCCCCGCCGCTCCTGCTGCAGCCCCAG
HKR167371 ARi18H03 pGCAP10 NM_000366.5  
GACTCCCGCTCCTCCGCCCGACCGCGCGCTCGCCCCGCCGCTCCTGCTGCAGCCCCAGGG
HKR167674 ARi19D02 pGCAP10 NM_000366.5  
GGCACTCCCGCTCCTCCGCCCGACCGCGCGCTCGCCCCGCCGCTCCTGCTGCAGCCCCAG
HKR174548 ARi36G04 pGCAP10 NM_000366.5  
GCGCACTCCCGCTCCTCCGCCCGACCGCGCGCTCGCCCCGCCGCTCCTGCTGCAGCCCCA
HKR177653 ARi44C05 pGCAP10 NM_000366.5  
GCGCACTCCCGCTCCTCCGCCCGACCGCGCGCTCGCCCCGCCGCTCCTGCTGCAGCCCCA
HKR179729 ARi49F09 pGCAP10 NM_000366.5  
GGGGAGAAGCAGGCGGCTCCGCGCTCGCACTCCCGCTCCTCCGCCCGACCGCGCGCTCGC
HKR180945 ARi52G01 pGCAP10 NM_000366.5  
GCGCACTCCCGCTCCTCCGCCCGACCGCGCGCTCGCCCCGCCGCTCCTGCTGCAGCCCCA
HKR181728 ARi54F08 pGCAP10 NM_000366.5  
GGCTCGCACTCCCGCTCCTCCGCCCGACCGCGCGCTCGCCCCGCCGCTCCTGCTGCAGCC
HKR183660 ARi59C12 pGCAP10 NM_000366.5  
GGCACTCCCGCTCCTCCGCCCGACCGCGCGCTCGCCCCGCCGCTCCTGCTGCAGCCCCAG
HKR186503 ARi66E07 pGCAP10 NM_000366.5  
GGCTCGCACTCCCGCTCCTCCGCCCGACCGCGCGCTCGCCCCGCCGCTCCTGCTGCAGCC
HKR218076 ARiS045D04 pGCAP10 NM_000366.5  
NCGGCCGGCCGATGGCTCGCACTCCCGCTCCTCCGCCCGACCGCGCGCTCGCCCCGCCGC
HKR219772 ARiS049H04 pGCAP10 NM_000366.5  
GGGCTGTCTTGAGGAATGCGGTCGCCCCCTTGGGAAAGTACATATCTGGGAGAAGCAGGC
HKR219805 ARiS049I13 pGCAP10 NM_000366.5  
GGCACTCCCGCTCCTCCGCCCGACCGCGCGCTCGCCCCGCCGCTCCTGCTGCAGCCCCAG
HKR222018 ARiS055A18 pGCAP10 NM_000366.5  
GGCACTCCCGCTCCTCCGCCCGACCGCGCGCTCGCCCCGCCGCTCCTGCTGCAGCCCCAG
HKR222200 ARiS055I08 pGCAP10 NM_000366.5  
GATGCGGTCGCCCCCTTGGGAAAGTACATATCTGGGAGAAGCAGGCGGCTCCGCGCTCGC
HKR235163 ARiS087P03 pGCAP10 NM_000366.5  
HKR238667 ARiS096L03 pGCAP10 NM_000366.5  
GGAAGGAGCTGACCAGCCAGCTGACCCCTCACACTCACCTAGCCACCATGGACATCGCCA
HKR238668 ARiS096L04 pGCAP10 NM_000366.5  
GGCTCGCACTCCCGCTCCTCCGCCCGACCGCGCGCTCGCCCCGCCGCTCCTGCTGCAGCC
HKR264545 ARiS161G01 pGCAP10 NM_000366.5  
GATATCTGGGAGAAGCAGGCGGCTCCGCGCTCGCACTCCCGCTCCTCCGCCCGACCGCGC
HKR276554 ARiS191G10 pGCAP10 NM_000366.5  
GGCACTCCCGCTCCTCCGCCCGACCGCGCGCTCGCCCCGCCGCTCCTGCTGCAGCCCCAG
HKR276649 ARiS191K09 pGCAP10 NM_000366.5  
TCGCACTCCCGCTCCTCCGCCCGACCGCNCGCTCGCCCCGCCGCTCCTGCTGCAGCCCCA
HKR337605 RBb44A05 pGCAP1 NM_000366.5  
GCCCCTTGGGAAAGTACATATCTGGGAGAAGCAGGCGGCTCCGCGCTCGCACTCCCGCTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl