Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00131

HP ID(1) HP00131
Gene ID(2) 26227
Gene Symbol finder PHGDH
Protein Name phosphoglycerate dehydrogenase
RefSeq NM_006623.3
Length of RefSeq (bp) 2021
Chromosome 1p12
Reference DDBJ accession
UniGene Hs.487296

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi10H11 pGCAP10 GACTGCGCCAGTTACTCTAGCGCGCCAGGCCGAACCGCAGCTTCTTGGCTTAGGTACTTC
ARi36H01 pGCAP10 GAGACTGTAAGAGGAGGAGGAGGAGGAGATGACTGGGGAGCGGGAGCTGGAGAATACTGC
ARiS118B23 pGCAP10 GGGAGGANNTGACTGGTTANCGGGAGCTGGAGAATACTGCCCNGTTACTCTAGCGCGCCA
ARiS198C19 pGCAP10 GAGACTGTAAGAGGAGGAGGAGGAGGAGATGACTGGGGAGCGGGAGCTGGAGAATACTGC
RBb12H01 pKA1U5 GTTTCTTGGCTTAGGTACTTCTACTCACAGCGGCCGATTCCGAGGCCAACTCCAGCAATG
RBd72E07 pGCAP10 GGTTACTCTAGCGCGCCAGGCCGAACCGCAGCTTCTTGGCTTAGGTACTTCTACTCACAG
RBdS007E23 pGCAP10 GCAGTTACTCTAGCGCGCCAGGCCGAACCGCAGCTTCTTGGCTTAGGTACTTCTACTCAC
RBdS156E01 pGCAP10 GGAGGAGATGACTGGGGAGCGGGAGCTCGAGAATACTGCCCAGTTACTCTAGCGCGCCAG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl