Prev. |  KEGG KO K00058 > 

RIKEN DNA Bank Human Resource - PHGDH

Gene ID NCBI Gene 26227 |  KEGG hsa:26227
Gene Symbol PHGDH
Protein Name phosphoglycerate dehydrogenase
Synonyms 3-PGDH|3PGDH|HEL-S-113|NLS|NLS1|PDG|PGAD|PGD|PGDH|PHGDHD|SERA
Ortholog resource in our bank

  PHGDH

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX004903 IRAK012E07 pCMV-SPORT6 BC011262 NM_006623
HGY080463 IRAL001C15 pOTB7 BC000303 NM_006623 Full
HGY080700 IRAL001M12 pOTB7 BC001349 NM_006623 Full
HGY093434 IRAL033J18 pOTB7 BC032110 NM_006623 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE041507 W01A103M19 pENTR-TOPO IRAL001C15 BC000303 NM_006623  
HGE041537 W01A103O01 pENTR-TOPO IRAL001C15 BC000303 NM_006623  
HGE041539 W01A103O03 pENTR-TOPO IRAL001C15 BC000303 NM_006623  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR164179 ARi10H11 pGCAP10 NM_006623.3  
GACTGCGCCAGTTACTCTAGCGCGCCAGGCCGAACCGCAGCTTCTTGGCTTAGGTACTTC
HKR174569 ARi36H01 pGCAP10 NM_006623.3  
GAGACTGTAAGAGGAGGAGGAGGAGGAGATGACTGGGGAGCGGGAGCTGGAGAATACTGC
HKR247247 ARiS118B23 pGCAP10 NM_006623.3  
GGGAGGANNTGACTGGTTANCGGGAGCTGGAGAATACTGCCCNGTTACTCTAGCGCGCCA
HKR279267 ARiS198C19 pGCAP10 NM_006623.3  
GAGACTGTAAGAGGAGGAGGAGGAGGAGATGACTGGGGAGCGGGAGCTGGAGAATACTGC
HKR324969 RBb12H01 pKA1U5 NM_006623.3  
GTTTCTTGGCTTAGGTACTTCTACTCACAGCGGCCGATTCCGAGGCCAACTCCAGCAATG
HKR388903 RBd72E07 pGCAP10 NM_006623.3  
GGTTACTCTAGCGCGCCAGGCCGAACCGCAGCTTCTTGGCTTAGGTACTTCTACTCACAG
HKR402919 RBdS007E23 pGCAP10 NM_006623.3  
GCAGTTACTCTAGCGCGCCAGGCCGAACCGCAGCTTCTTGGCTTAGGTACTTCTACTCAC
HKR462497 RBdS156E01 pGCAP10 NM_006623.3  
GGAGGAGATGACTGGGGAGCGGGAGCTCGAGAATACTGCCCAGTTACTCTAGCGCGCCAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl