Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00115

HP ID(1) HP00115
Gene ID(2) 10383
Gene Symbol finder TUBB2C
Protein Name tubulin, beta 2C
RefSeq NM_006088.5
Length of RefSeq (bp) 1591
Chromosome 9q34
Reference DDBJ accession
UniGene Hs.433615

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe11H08 pKA1U5 AGCACTCTGCGCGCCCGCTCTTCTGCTGCTGTTTGTCTACTTCCTCCTGCTTCCCCGCCG
ARe41D08 pKA1U5 GGCACTCTGCGCGCCCGCTCTTCTGCTGCTGTTTGTCTACTTCCTCCTGCTTCCCCGCCG
ARe41F08 pKA1U5 AGCACTCTGCGCGCCCGCTCTTCTGCTGCTGTTTGTCTACTTCCTCCTGCTTCCCCGCCG
ARi13H05 pGCAP10 GAGCACTCTGCGCGCCCGCTCTTCTGCTGCTGTTTGTCTACTTCCTCCTGCTTCCCCGCC
ARi65H06 pGCAP10 AGCACTCTGCGCGCCCGCTCTTCTGCTGCTGTTTGTCTACTTCCTCCTGCTTCCCCGCCG
ARiS049F23 pGCAP10 GACTCTGCGCGCCCGCTCTTCTGCTGCTGTTTGTCTACTTCCTCCTGCTTCCCCGCCGCC
ARiS122C15 pGCAP10 GAGCACTCTGCGCGCCCGCTCTNCTGCTGCTGTTTGTCTACTTCCTCCTGCTTCCCCGCC
ARiS161B14 pGCAP10 GAGCACTCTGCGCGCCCGCTCTTCTGCTGCTGTTTGTCTACTTCCTCCTGCTTCCCCGCC
ARiS161B16 pGCAP10 GGCACTCTGCGCGCCCGCTCTTCTGCTGCTGTTTGTCTACTTCCTCCTGCTTCCCCGCCG
RBb11C07 pKA1U5 ATCCTGAGCACTCTGCGCGCCCGCTCTTCTGCTGCTGTTTGTCTACTTCCTCCTGCTTCC
RBb16G04 pKA1U5 GACTCTGCGCGCCCGCTCTTCTGCTGCTGTTTGTCTACTTCCTCCTGCTTCCCCGCCGCC
RBb21E07 pKA1U5 GACTCTGCGCGCCCGCTCTTCTGCTGCTGTTTGTCTACTTCCTCCTGCTTCCCCGCCGCC
RBb21E08 pKA1U5 GACTCTGCGCGCCCGCTCTTCTGCTGCTGTTTGTCTACTTCCTCCTGCTTCCCCGCCGCC
RBb58F08 pGCAP1 GACTCTGCGCGCCCGCTCTTCTGCTGCTGTTTGTCTACTTCCTCCTGCTTCCCCGCCGCC
RBb59E11 pGCAP1 AGCACTCTGCGCGCCCGCTCTTCTGCTGCTGTTTGTCTACTTCCTCCTGCTTCCCCGCCG
RBb64A08 pGCAP1 TGACTCTGCGCGCCCGCTCTTCTGCTGCTGTTTGTCTACTTCCTCCTGCTTCCCCGCCGC
RBd05G05 pGCAP10 GAGCACTCTGCGCGCCCGCTCTTCTGCTGCTGTTTGTCTACTTCCTCCTGCTTCCCCGCC
RBd18A10 pGCAP10 GACTCTGCGCGCCCGCTCTTCTGCTGCTGTTTGTCTACTTCCTCCTGCTTCCCCGCCGCC
RBd22G04 pGCAP10 GGCGTTTGCACCTCGCTGCTCCAGCCTCTGGGGCGCATTCCAACCTTCCAGCCTGCGACC
RBd30B12 pGCAP10 GGCACTCTGCGCGCCCGCTCTTCTGCTGCTGTTTGTCTACTTCCTCCTGCTTCCCCGCCG
RBd39D06 pGCAP10 GAGCACTCTGCGCGCCCGCTCTTCTGCTGCTGTTTGTCTACTTCCTCCTGCTTCCCCGCC
RBd42H09 pGCAP10 GAGCACTCTGCGCGCCCGCTCTTCTGCTGCTGTTTGTCTACTTCCTCCTGCTTCCCCGCC
RBd53B11 pGCAP10 GAGCACTCTGCGCGCCCGCTCTTCTGCTGCTGTTTGTCTACTTCCTCCTGCTTCCCCGCC
RBd59A09 pGCAP10 GGCACTCTGCGCGCCCGCTCTTCTGCTGCTGTTTGTCTACTTCCTCCTGCTTCCCCGCCG
RBd59D01 pGCAP10 AGCACTCTGCGCGCCCGCTCTTCTGCTGCTGTTTGTCTACTTCCTCCTGCTTCCCCGCCG
RBd64C03 pGCAP10 GAGCACTCTGCGCGCCCGCTCTTCTGCTGCTGTTTGTCTACTTCCTCCTGCTTCCCCGCC
RBd72G09 pGCAP10 GACTCTGCGCGCCCGCTCTTCTGCTGCTGTTTGTCTACTTCCTCCTGCTTCCCCGCCGCC
RBd87F02 pGCAP10 GAGCACTCTGCGCGCCCGCTCTTCTGCTGCTGTTTGTCTACTTCCTCCTGCTTCCCCGCC
RBd88F04 pGCAP10 TGAGCACTCTGCGCGCCCGCTCTTCTGCTGCTGTTTGTCTACTTCCTCCTGCTTCCCCGC
RBd95E07 pGCAP10 GAGCACTCTGCGCGCCCGCTCTTCTGCTGCTGTTTGTCTACTTCCTCCTGCTTCCCCGCC
RBd96C09 pGCAP10 GGGACCTTAGGCAGCTTGATTGACGGGGGCAAGGCCAATCAAACGAGGGAGCTTGCCAGC
RBdS022K11 pGCAP10 GAGCACTCTGCGCGCCCGCTCTTCTGCTGCTGTTTGTCTACTTCCTCCTGCTTCCCCGCC
RBdS040L19 pGCAP10 TAATGATTGAGCACTCTGCGCGCCCGCTCTTCTGCTGCTGTTTGTCTACTTCCTCCTGCT
RBdS081J11 pGCAP10 GGCACTCTGCGCGCCCGCTCTTCTGCTGCTGTTTGTCTACTTCCTCCTGCTTCCCCGCCG
RBdS083O10 pGCAP10 GGCACTCTGCGCGCCCGCTCTTCTGCTGCTGTTTGTCTACTTCCTCCTGCTTCCCCGCCG
RBdS132D07 pGCAP10 GACTCTGCGCGCCCGCTCTTCTGCTGCTGTTTGTCTACTTCCTCCTGCTTCCCCGCCGCC
RBdS154B19 pGCAP10 GAGCACTCTGCGCGCCCGCTCTTCTGCTGCTGTTTGTCTACTTCCTCCTGCTTCCCCGCC
RBdS154C07 pGCAP10 GAGCACTCTGCGCGCCCGCTCTTCTGCTGCTGTTTGTCTACTTCCTCCTGCTTCCCCGCC
RBdS154F24 pGCAP10 GAGCACTCTGCGCGCCCGCTCTTCTGCTGCTGTTTGTCTACTTCCTCCTGCTTCCCCGCC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl