Prev. |  KEGG KO K07375 > 

RIKEN DNA Bank Human Resource - TUBB4B

Gene ID NCBI Gene 10383 |  KEGG hsa:10383
Gene Symbol TUBB4B
Protein Name tubulin beta 4B class IVb
Synonyms Beta2|LCAEOD|TUBB2|TUBB2C
Ortholog resource in our bank

  TUBB4B

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB19413 pFX-beta-tubulin-SECFP Expression vector of SECFP with microtuble-targeting sequence (human TUBB4B) in mammalian cells.

webcatalog20220516.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX010753 IRAK026O17 pCMV-SPORT6 BC039175 NM_006088 Full
HGX017097 IRAK042M09 pCMV-SPORT6 BC019829 NM_006088 Full
HGY019328 IRAK048F08 pBluescriptR BC029529 NM_006088 Full/var
HGY081134 IRAL002N22 pOTB7 BC004188 NM_006088 Full
HGY083468 IRAL008L04 pOTB7 BC001911 NM_006088 Full
HGY084440 IRAL011B16 pOTB7 BC012835 NM_006088 Full
HGY084969 IRAL012H01 pOTB7 BC002783 NM_006088 Full
HGY086167 IRAL015G23 pOTB7 BC002885 NM_006088 Full
HGY087520 IRAL018N08 pOTB7 BC019359 NM_006088 Full
HGY088123 IRAL020F03 pOTB7 BC007889 NM_006088 Full
HGY103317 IRAL058E21 pOTB7 BC071889 NM_006088 Full
HGY085425 IRAL013J09 pOTB7 BC024038 NM_006088 Full/var
HGY089320 IRAL023E24 pOTB7 BC008006 NM_006088 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2022Apr03.csv
GNP_full_IRAL_2022Apr03.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE037890 W01A094M02 pENTR-TOPO flj0060p08 AK026594 NM_006088  
HGE037892 W01A094M04 pENTR-TOPO flj0060p08 AK026594 NM_006088  
HGE037896 W01A094M08 pENTR-TOPO flj0060p08 AK026594 NM_006088  
HGE037906 W01A094M18 pENTR-TOPO flj0060p08 AK026594 NM_006088  
HGE037908 W01A094M20 pENTR-TOPO flj0060p08 AK026594 NM_006088  
HGE047253 W01A118C05 pENTR-TOPO flj0060p08 AK026594 NM_006088  
HGE047257 W01A118C09 pENTR-TOPO flj0060p08 AK026594 NM_006088  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2022Apr03.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR044576 ARe11H08 pKA1U5 NM_006088.5  
AGCACTCTGCGCGCCCGCTCTTCTGCTGCTGTTTGTCTACTTCCTCCTGCTTCCCCGCCG
HKR056480 ARe41D08 pKA1U5 NM_006088.5  
GGCACTCTGCGCGCCCGCTCTTCTGCTGCTGTTTGTCTACTTCCTCCTGCTTCCCCGCCG
HKR056528 ARe41F08 pKA1U5 NM_006088.5  
AGCACTCTGCGCGCCCGCTCTTCTGCTGCTGTTTGTCTACTTCCTCCTGCTTCCCCGCCG
HKR165373 ARi13H05 pGCAP10 NM_006088.5  
GAGCACTCTGCGCGCCCGCTCTTCTGCTGCTGTTTGTCTACTTCCTCCTGCTTCCCCGCC
HKR186174 ARi65H06 pGCAP10 NM_006088.5  
AGCACTCTGCGCGCCCGCTCTTCTGCTGCTGTTTGTCTACTTCCTCCTGCTTCCCCGCCG
HKR219743 ARiS049F23 pGCAP10 NM_006088.5  
GACTCTGCGCGCCCGCTCTTCTGCTGCTGTTTGTCTACTTCCTCCTGCTTCCCCGCCGCC
HKR248863 ARiS122C15 pGCAP10 NM_006088.5  
GAGCACTCTGCGCGCCCGCTCTNCTGCTGCTGTTTGTCTACTTCCTCCTGCTTCCCCGCC
HKR264438 ARiS161B14 pGCAP10 NM_006088.5  
GAGCACTCTGCGCGCCCGCTCTTCTGCTGCTGTTTGTCTACTTCCTCCTGCTTCCCCGCC
HKR264440 ARiS161B16 pGCAP10 NM_006088.5  
GGCACTCTGCGCGCCCGCTCTTCTGCTGCTGTTTGTCTACTTCCTCCTGCTTCCCCGCCG
HKR324455 RBb11C07 pKA1U5 NM_006088.5  
ATCCTGAGCACTCTGCGCGCCCGCTCTTCTGCTGCTGTTTGTCTACTTCCTCCTGCTTCC
HKR326548 RBb16G04 pKA1U5 NM_006088.5  
GACTCTGCGCGCCCGCTCTTCTGCTGCTGTTTGTCTACTTCCTCCTGCTTCCCCGCCGCC
HKR328503 RBb21E07 pKA1U5 NM_006088.5  
GACTCTGCGCGCCCGCTCTTCTGCTGCTGTTTGTCTACTTCCTCCTGCTTCCCCGCCGCC
HKR328504 RBb21E08 pKA1U5 NM_006088.5  
GACTCTGCGCGCCCGCTCTTCTGCTGCTGTTTGTCTACTTCCTCCTGCTTCCCCGCCGCC
HKR343328 RBb58F08 pGCAP1 NM_006088.5  
GACTCTGCGCGCCCGCTCTTCTGCTGCTGTTTGTCTACTTCCTCCTGCTTCCCCGCCGCC
HKR343707 RBb59E11 pGCAP1 NM_006088.5  
AGCACTCTGCGCGCCCGCTCTTCTGCTGCTGTTTGTCTACTTCCTCCTGCTTCCCCGCCG
HKR345608 RBb64A08 pGCAP1 NM_006088.5  
TGACTCTGCGCGCCCGCTCTTCTGCTGCTGTTTGTCTACTTCCTCCTGCTTCCCCGCCGC
HKR362149 RBd05G05 pGCAP10 NM_006088.5  
GAGCACTCTGCGCGCCCGCTCTTCTGCTGCTGTTTGTCTACTTCCTCCTGCTTCCCCGCC
HKR367210 RBd18A10 pGCAP10 NM_006088.5  
GACTCTGCGCGCCCGCTCTTCTGCTGCTGTTTGTCTACTTCCTCCTGCTTCCCCGCCGCC
HKR368948 RBd22G04 pGCAP10 NM_006088.5  
GGCGTTTGCACCTCGCTGCTCCAGCCTCTGGGGCGCATTCCAACCTTCCAGCCTGCGACC
HKR372036 RBd30B12 pGCAP10 NM_006088.5  
GGCACTCTGCGCGCCCGCTCTTCTGCTGCTGTTTGTCTACTTCCTCCTGCTTCCCCGCCG
HKR375678 RBd39D06 pGCAP10 NM_006088.5  
GAGCACTCTGCGCGCCCGCTCTTCTGCTGCTGTTTGTCTACTTCCTCCTGCTTCCCCGCC
HKR376977 RBd42H09 pGCAP10 NM_006088.5  
GAGCACTCTGCGCGCCCGCTCTTCTGCTGCTGTTTGTCTACTTCCTCCTGCTTCCCCGCC
HKR381235 RBd53B11 pGCAP10 NM_006088.5  
GAGCACTCTGCGCGCCCGCTCTTCTGCTGCTGTTTGTCTACTTCCTCCTGCTTCCCCGCC
HKR383609 RBd59A09 pGCAP10 NM_006088.5  
GGCACTCTGCGCGCCCGCTCTTCTGCTGCTGTTTGTCTACTTCCTCCTGCTTCCCCGCCG
HKR383673 RBd59D01 pGCAP10 NM_006088.5  
AGCACTCTGCGCGCCCGCTCTTCTGCTGCTGTTTGTCTACTTCCTCCTGCTTCCCCGCCG
HKR385651 RBd64C03 pGCAP10 NM_006088.5  
GAGCACTCTGCGCGCCCGCTCTTCTGCTGCTGTTTGTCTACTTCCTCCTGCTTCCCCGCC
HKR388953 RBd72G09 pGCAP10 NM_006088.5  
GACTCTGCGCGCCCGCTCTTCTGCTGCTGTTTGTCTACTTCCTCCTGCTTCCCCGCCGCC
HKR394922 RBd87F02 pGCAP10 NM_006088.5  
GAGCACTCTGCGCGCCCGCTCTTCTGCTGCTGTTTGTCTACTTCCTCCTGCTTCCCCGCC
HKR395324 RBd88F04 pGCAP10 NM_006088.5  
TGAGCACTCTGCGCGCCCGCTCTTCTGCTGCTGTTTGTCTACTTCCTCCTGCTTCCCCGC
HKR398103 RBd95E07 pGCAP10 NM_006088.5  
GAGCACTCTGCGCGCCCGCTCTTCTGCTGCTGTTTGTCTACTTCCTCCTGCTTCCCCGCC
HKR398457 RBd96C09 pGCAP10 NM_006088.5  
GGGACCTTAGGCAGCTTGATTGACGGGGGCAAGGCCAATCAAACGAGGGAGCTTGCCAGC
HKR409051 RBdS022K11 pGCAP10 NM_006088.5  
GAGCACTCTGCGCGCCCGCTCTTCTGCTGCTGTTTGTCTACTTCCTCCTGCTTCCCCGCC
HKR416283 RBdS040L19 pGCAP10 NM_006088.5  
TAATGATTGAGCACTCTGCGCGCCCGCTCTTCTGCTGCTGTTTGTCTACTTCCTCCTGCT
HKR432627 RBdS081J11 pGCAP10 NM_006088.5  
GGCACTCTGCGCGCCCGCTCTTCTGCTGCTGTTTGTCTACTTCCTCCTGCTTCCCCGCCG
HKR433546 RBdS083O10 pGCAP10 NM_006088.5  
GGCACTCTGCGCGCCCGCTCTTCTGCTGCTGTTTGTCTACTTCCTCCTGCTTCCCCGCCG
HKR452879 RBdS132D07 pGCAP10 NM_006088.5  
GACTCTGCGCGCCCGCTCTTCTGCTGCTGTTTGTCTACTTCCTCCTGCTTCCCCGCCGCC
HKR461643 RBdS154B19 pGCAP10 NM_006088.5  
GAGCACTCTGCGCGCCCGCTCTTCTGCTGCTGTTTGTCTACTTCCTCCTGCTTCCCCGCC
HKR461655 RBdS154C07 pGCAP10 NM_006088.5  
GAGCACTCTGCGCGCCCGCTCTTCTGCTGCTGTTTGTCTACTTCCTCCTGCTTCCCCGCC
HKR461744 RBdS154F24 pGCAP10 NM_006088.5  
GAGCACTCTGCGCGCCCGCTCTTCTGCTGCTGTTTGTCTACTTCCTCCTGCTTCCCCGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv


2022.07.27

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl