Prev. | NRCD Clone O | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00103

HP ID(1) HP00103
Gene ID(2) 4953
Gene Symbol finder ODC1
Protein Name ornithine decarboxylase 1
RefSeq NM_002539.1
Length of RefSeq (bp) 2062
Chromosome 2p25
Reference DDBJ accession
UniGene Hs.467701

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi08D02 pGCAP10 GANTTGNTCAGTCCCTCCTGTACCCGCCGCCGCCGCCGCCCGCCGCCCCTCTGCCAGCAG
ARi51C06 pGCAP10 GGTCAGTCCCTCCTGTAGCCGCCGCCGCCGCCGCCCGCCGCCCCTCTGCCAGCAGCTCCG
ARiS049E03 pGCAP10 GGTCAGTCCCTCCTGTAGCCGCCGCCGCCGCCGCCCGCCGCCCCTCTGCCAGCAGCTCCG
RBb09C07 pKA1U5 TGGTCAGTCCCTCCTGTAGCCGCCGCCGCCGCCGCCCGCCGCCCCTCTGCCAGCAGCTCC
RBb10A03 pKA1U5 TTTGGTCAGTCCCTCCTGTAGCCGCCGCCGCCGCCGCCCGCCGCCCCTCTGCCAGCAGCG
RBb40C03 pGCAP1 GGTCAGTCCCTCCTGTAGCCGCCGCCGCCGCCGCCCGCCGCCCCTCTGCCAGCAGCTCCG
RBb54B11 pGCAP1 GGTCAGTCCCTCCTGTAGCCGCCGCCGCCGCCGCCCGCCGCCCCTCTGCCAGCAGCTCCG
RBb54F08 pGCAP1 GGTCAGTCCCTCCTGTAGCCGCCGCCGCCGCCGCCCGCCGCCCCTCTGCCAGCAGCTCCG
RBd48G11 pGCAP10 GGTCAGTCCCTCCTGTAGCCGCCGCCGCCGCCGCCCGCCGCCCCTCTGCCAGCAGCTCCG
RBd57A03 pGCAP10 TGNTCAGTCCCTCCTGTAGCCGCCGCCGCCGCCGCCCGCCNCCCNTNNNCCAGCAGCTCC
RBd58A10 pGCAP10 GTGTCAGTCCCTCCTGTAGCCGCCGCCGCCGCCGCCCGCCGCNNNNNNGNNNNCAGCTCC
RBd86E09 pGCAP10 GGTCAGTCCCTCCTGTAGCCGCCGCCGCCGCCGCCCGCCGCCCCTCTGCCAGCAGCTCCG
RBdS015K04 pGCAP10 GGTCAGTCCCTCCTGTAGCCGCCGCCGCCGCCGCCCGCCGCCCCTCTGCCAGCAGCTCCG
RBdS022L14 pGCAP10 GGTCAGTCCCTCCTGTAGCCGCCGCCGCCGCCGCCCGCCGCCCCTCTGCCAGCAGCTCCG
RBdS051O13 pGCAP10 GGCTTTGTCAGTCCCTCCTGTAGCCGCCGCCGCCGCCGCCCGCCGCCCCTCTGCCAGCAG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl