Prev. |  KEGG KO K01581 > 

RIKEN DNA Bank Human Resource - ODC1

Gene ID NCBI Gene 4953 |  KEGG hsa:4953
Gene Symbol ODC1
Protein Name ornithine decarboxylase 1
Synonyms ODC
Ortholog resources KEGG ortholog (KEGG orthology K01581) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY083077 IRAL007L13 pOTB7 BC014562 NM_002539 Full/var
HGY097111 IRAL042M23 pOTB7 BC025296 NM_002539 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR163274 ARi08D02 pGCAP10 NM_002539.1  
GANTTGNTCAGTCCCTCCTGTACCCGCCGCCGCCGCCGCCCGCCGCCCCTCTGCCAGCAG
HKR180454 ARi51C06 pGCAP10 NM_002539.1  
GGTCAGTCCCTCCTGTAGCCGCCGCCGCCGCCGCCCGCCGCCCCTCTGCCAGCAGCTCCG
HKR219699 ARiS049E03 pGCAP10 NM_002539.1  
GGTCAGTCCCTCCTGTAGCCGCCGCCGCCGCCGCCCGCCGCCCCTCTGCCAGCAGCTCCG
HKR323655 RBb09C07 pKA1U5 NM_002539.1  
TGGTCAGTCCCTCCTGTAGCCGCCGCCGCCGCCGCCCGCCGCCCCTCTGCCAGCAGCTCC
HKR324003 RBb10A03 pKA1U5 NM_002539.1  
TTTGGTCAGTCCCTCCTGTAGCCGCCGCCGCCGCCGCCCGCCGCCCCTCTGCCAGCAGCG
HKR336051 RBb40C03 pGCAP1 NM_002539.1  
GGTCAGTCCCTCCTGTAGCCGCCGCCGCCGCCGCCCGCCGCCCCTCTGCCAGCAGCTCCG
HKR341635 RBb54B11 pGCAP1 NM_002539.1  
GGTCAGTCCCTCCTGTAGCCGCCGCCGCCGCCGCCCGCCGCCCCTCTGCCAGCAGCTCCG
HKR341728 RBb54F08 pGCAP1 NM_002539.1  
GGTCAGTCCCTCCTGTAGCCGCCGCCGCCGCCGCCCGCCGCCCCTCTGCCAGCAGCTCCG
HKR379355 RBd48G11 pGCAP10 NM_002539.1  
GGTCAGTCCCTCCTGTAGCCGCCGCCGCCGCCGCCCGCCGCCCCTCTGCCAGCAGCTCCG
HKR382803 RBd57A03 pGCAP10 NM_002539.1  
TGNTCAGTCCCTCCTGTAGCCGCCGCCGCCGCCGCCCGCCNCCCNTNNNCCAGCAGCTCC
HKR383210 RBd58A10 pGCAP10 NM_002539.1  
GTGTCAGTCCCTCCTGTAGCCGCCGCCGCCGCCGCCCGCCGCNNNNNNGNNNNCAGCTCC
HKR394505 RBd86E09 pGCAP10 NM_002539.1  
GGTCAGTCCCTCCTGTAGCCGCCGCCGCCGCCGCCCGCCGCCCCTCTGCCAGCAGCTCCG
HKR406244 RBdS015K04 pGCAP10 NM_002539.1  
GGTCAGTCCCTCCTGTAGCCGCCGCCGCCGCCGCCCGCCGCCCCTCTGCCAGCAGCTCCG
HKR409078 RBdS022L14 pGCAP10 NM_002539.1  
GGTCAGTCCCTCCTGTAGCCGCCGCCGCCGCCGCCCGCCGCCCCTCTGCCAGCAGCTCCG
HKR420749 RBdS051O13 pGCAP10 NM_002539.1  
GGCTTTGTCAGTCCCTCCTGTAGCCGCCGCCGCCGCCGCCCGCCGCCCCTCTGCCAGCAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl