Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00098

HP ID(1) HP00098
Gene ID(2) 5621
Gene Symbol finder PRNP
Protein Name prion protein
RefSeq NM_000311.3
Length of RefSeq (bp) 2755
Chromosome 20p13
Reference DDBJ accession
UniGene Hs.472010

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe48H10 pKA1U5 GGCTGACAGCCGCGGCGCCGCGAGCTTCTCCTCTCTTCACGACCGAGAGCAGTCATTATG
ARe56C02 pKA1U5 GGCCAGATCGCTGACAGCCGCGGCGCCGCGAGCTTCTNCTCTCCTCACGACCGAGGCAGA
ARi34G06 pGCAP10 GAGTCGCTGACAGCCGCGGCGCCGCGAGCTTCTCCTCTCCTCACGACCGAGAGCAGTCAT
ARi42A06 pGCAP10 GGACAGCCGCGGCGCCGCGAGCTTCTCCTCTCCTCACGACCGAGGCAGAGCAGTCATTAT
ARiS161G13 pGCAP10 GGCCAGTCGCTGACAGCCGCGGCGCCGCGAGCTTCTCCTCTCCTCACGACCGAGGCAGAG
RBb20B07 pKA1U5 GGCCAGTCGCTGACAGCCGCGGCGCCGCGAGCTTCTCCTCTCCTCACGACCGAGGCAGAG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl