Prev. |  KEGG KO K05634 > 

RIKEN DNA Bank Human Resource - PRNP

Gene ID NCBI Gene 5621 |  KEGG hsa:5621
Gene Symbol PRNP
Protein Name prion protein
Synonyms ASCR|AltPrP|CD230|CJD|GSS|KURU|PRIP|PrP|PrP27-30|PrP33-35C|PrPc|p27-30
Ortholog resources KEGG ortholog (KEGG orthology K05634) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB06716 hPrP129M in pTA2 Plasmid clone of human prion cDNA
RDB06717 hPrP129V in pTA2 Plasmid clone of human prion cDNA
RDB06718 hPrPSV129M in pTA2 Plasmid clone of splice variant of prion
RDB06719 hPrPSV129V in pTA2 Plasmid clone of splice variant of prion
RDB12404 hPrP 129M with signal sequences Plasmid clone of splice variant of prion
RDB12405 hPrP 129V with signal sequences Plasmid clone of splice variant of prion

RDB_org_190226.csv


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX008606 IRAK021I14 pCMV-SPORT6 BC012844 NM_183079 Full/var
HGY013052 IRAK032K12 pBluescriptR BC022532 NM_183079 Full/var
HGY093043 IRAL032K03 pDNR-LIB BC016809 NM_183079 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE040767 W01A101P07 pENTR-TOPO IRAK021I14 BC012844 NM_183079 done

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR059378 ARe48H10 pKA1U5 NM_000311.3  
GGCTGACAGCCGCGGCGCCGCGAGCTTCTCCTCTCTTCACGACCGAGAGCAGTCATTATG
HKR062450 ARe56C02 pKA1U5 NM_000311.3  
GGCCAGATCGCTGACAGCCGCGGCGCCGCGAGCTTCTNCTCTCCTCACGACCGAGGCAGA
HKR173750 ARi34G06 pGCAP10 NM_000311.3  
GAGTCGCTGACAGCCGCGGCGCCGCGAGCTTCTCCTCTCCTCACGACCGAGAGCAGTCAT
HKR176806 ARi42A06 pGCAP10 NM_000311.3  
GGACAGCCGCGGCGCCGCGAGCTTCTCCTCTCCTCACGACCGAGGCAGAGCAGTCATTAT
HKR264557 ARiS161G13 pGCAP10 NM_000311.3  
GGCCAGTCGCTGACAGCCGCGGCGCCGCGAGCTTCTCCTCTCCTCACGACCGAGGCAGAG
HKR328031 RBb20B07 pKA1U5 NM_000311.3  
GGCCAGTCGCTGACAGCCGCGGCGCCGCGAGCTTCTCCTCTCCTCACGACCGAGGCAGAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.09.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_190501.pl