Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00092

HP ID(1) HP00092
Gene ID(2) 5685
Gene Symbol finder PSMA4
Protein Name proteasome (prosome, macropain) subunit, alpha type, 4
RefSeq NM_002789.4
Length of RefSeq (bp) 1235
Chromosome 15q25.1
Reference DDBJ accession
UniGene Hs.251531

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe63H02 pKA1U5 GATATTAGCAGCGGTTATTCGGTGAGCGGTGGTGGTTTATTCTTCCGTGGAGTTAAGGGC
ARiS087F10 pGCAP10 GGCGGGGGCCATATTAGCAGCGGTTATTCGGTGAGCGGTGGTGGTTTATTCTTCCGTGGA
RBb21E02 pKA1U5 GGGGCCATATTATCAGCGGTTATTCGGTGAGCGGTGGTGGTTTATTCTTCCGTGGAGTTA
RBb49D07 pGCAP1 GGGGGGCCATATTATCAGCGGTTTATTCGGTGAGCGGTGGCCCNTTTAANCTTCCGAGGA
RBb61B01 pGCAP1 TGGGGCCATATTATCAGCGGTTATTCGGTGAGCGGTGGTGGTTTATTCTTCCGTGGAGTT
RBd04G04 pGCAP10 GATCAGCGGTTATTCGGTGAGCGGTGGTGGTTTATTCTTCCGTGGAGTTAAGGGCTCCGT
RBd24C09 pGCAP10 GATATTATCAGCGGTTATTCGGTGAGCGGTGGTGGTTTATTCTTCCGTGGAGTTAAGGGC
RBd28D05 pGCAP10 GATATATTATCAGCGGTTATTCGGTGAGCGGTGGTGGTTTATTCTTCCGTGGAGTTAAGG
RBd60A01 pGCAP10 GATCTGCGGTTATTCCGTGAACGGTGGTGGTTTATTCTTCCGTGGAGTTAGGGGCTCCGT
RBdS105G04 pGCAP10 GGCGCATGCGCGGGGGCCATATTATCAGCGGTTATTCGGTGAGCGGTGGTGGTTTATTCT
RBdS156H05 pGCAP10 GATATTATCAGCGGTTATTCGGTGAGCGGTGGTGGTTTATTCTTCCGTGGAGTTAAGGGC
RBdS156H24 pGCAP10 GGGCCATATTATCAGCGGTTATTCGGTGAGCGGTGGTGGTTTATTCTTCCGTGGAGTTAA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl