Prev. |  KEGG KO K02728 > 

RIKEN DNA Bank Human Resource - PSMA4

Gene ID NCBI Gene 5685 |  KEGG hsa:5685
Gene Symbol PSMA4
Protein Name proteasome subunit alpha 4
Synonyms HC9|HsT17706|PSC9
Ortholog resources KEGG ortholog (KEGG orthology K02728) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX039443 IRAK098K03 pCMV-SPORT6 BC047667 NM_002789 Full
HGY083026 IRAL007J10 pOTB7 BC001490 NM_002789 Partial/var
HGY086653 IRAL016K13 pDNR-LIB BC005361 NM_002789 Full
HGY094375 IRAL035P15 pDNR-LIB BC022445 NM_002789 Full
HGY097120 IRAL042N08 pOTB7 BC022817 NM_002789 Partial
HGY099222 IRAL048A22 pDNR-LIB BC056249 NM_002789 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE005223 W01A013A23 pENTR-TOPO IRAL016K13 BC005361 NM_002789  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR065370 ARe63H02 pKA1U5 NM_002789.4  
GATATTAGCAGCGGTTATTCGGTGAGCGGTGGTGGTTTATTCTTCCGTGGAGTTAAGGGC
HKR234930 ARiS087F10 pGCAP10 NM_002789.4  
GGCGGGGGCCATATTAGCAGCGGTTATTCGGTGAGCGGTGGTGGTTTATTCTTCCGTGGA
HKR328498 RBb21E02 pKA1U5 NM_002789.4  
GGGGCCATATTATCAGCGGTTATTCGGTGAGCGGTGGTGGTTTATTCTTCCGTGGAGTTA
HKR339679 RBb49D07 pGCAP1 NM_002789.4  
GGGGGGCCATATTATCAGCGGTTTATTCGGTGAGCGGTGGCCCNTTTAANCTTCCGAGGA
HKR344425 RBb61B01 pGCAP1 NM_002789.4  
TGGGGCCATATTATCAGCGGTTATTCGGTGAGCGGTGGTGGTTTATTCTTCCGTGGAGTT
HKR361748 RBd04G04 pGCAP10 NM_002789.4  
GATCAGCGGTTATTCGGTGAGCGGTGGTGGTTTATTCTTCCGTGGAGTTAAGGGCTCCGT
HKR369657 RBd24C09 pGCAP10 NM_002789.4  
GATATTATCAGCGGTTATTCGGTGAGCGGTGGTGGTTTATTCTTCCGTGGAGTTAAGGGC
HKR371277 RBd28D05 pGCAP10 NM_002789.4  
GATATATTATCAGCGGTTATTCGGTGAGCGGTGGTGGTTTATTCTTCCGTGGAGTTAAGG
HKR384001 RBd60A01 pGCAP10 NM_002789.4  
GATCTGCGGTTATTCCGTGAACGGTGGTGGTTTATTCTTCCGTGGAGTTAGGGGCTCCGT
HKR442148 RBdS105G04 pGCAP10 NM_002789.4  
GGCGCATGCGCGGGGGCCATATTATCAGCGGTTATTCGGTGAGCGGTGGTGGTTTATTCT
HKR462573 RBdS156H05 pGCAP10 NM_002789.4  
GATATTATCAGCGGTTATTCGGTGAGCGGTGGTGGTTTATTCTTCCGTGGAGTTAAGGGC
HKR462592 RBdS156H24 pGCAP10 NM_002789.4  
GGGCCATATTATCAGCGGTTATTCGGTGAGCGGTGGTGGTTTATTCTTCCGTGGAGTTAA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl