Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00066

HP ID(1) HP00066
Gene ID(2) 5223
Gene Symbol finder PGAM1
Protein Name phosphoglycerate mutase 1 (brain)
RefSeq NM_002629.2
Length of RefSeq (bp) 1762
Chromosome 10q25.3
Reference DDBJ accession
UniGene Hs.632918

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe04A10 pKA1U5 GGCCGCATCCCCAGCCCGCCGCCATGGCCGCCTACAAACTGGTGCTGATCCGGCACGGCG
ARe12E12 pKA1U5 GAGCCCGCCGCCATGGCCGCCTACAAACTGGTGCTGNTCCGGCACGGCGAGAGCGCATGG
ARe14E03 pKA1U5 ATCCTGGAGTCGGTGCCGCATCCCCAGCCCGCCGCCATGGCCGCCTACAAACTGGTGCTG
ARe30C10 pKA1U5 AGATTTGGGCGAGAACTTGCGCGGGAGCCGGACTGAGCGGTGCGAGCGCGCAGGCGCGGC
ARe59A09 pKA1U5 GTACTCCGGAATCTGCTAATCCCAGTCGGTGCCGCATCCCCAGCCCGCCGCCATGGCCGC
ARe64D01 pKA1U5 GGGTGCCGCATCCCCAGCCCGCCGCCATGGCCGCCTACAAACTGGTGCTGATCCGGCACG
ARe97F07 pKA1U5 TGTGGCGAGCGCGCAGGCGCGGCCGACGGGGCGGGCTGCTACTCCGGAATCTGCTAATCC
ARi01D02 pGCAP10 GGGTGCCGCATCCCCAGCCCGCCGCCATGGCCGCCTACAAACTGGTGCTGATCCGGCACG
ARi11A01 pGCAP10 GGGTGCCGCATCCCCAGCCCGCCGCCATGGCCGCCTACAAACTGGTGCTGATCCGGCACG
ARi19C08 pGCAP10 GAATCCCAGTCGGTGCCGCATCCCCAGCCCGCCGCCATGGCCGCCTACAAACTGGTGCTG
ARi26F10 pGCAP10 GGGACTGAGCGGTGCGAGCGCGCAGGCGCGGCCGACGGGGCGGGCTGCTACTCCGGAATC
ARi29H07 pGCAP10 GATCCCCAGCCCGCCGCCATGGCCGCCTACAAACTGGTGCTGATCCGGCACGGCGAGAGC
ARi35G09 pGCAP10 GGCCGCATCCCCAGCCCGCCGCCATGGCCGCCTACAAACTGGTGCTGATCCGGCACGGCG
ARi38D02 pGCAP10 GGCGGGCTGCTACTCCGGAATCTGCTAATCCCAGTCGGTGCCGCATCCCCAGCCCGCCGC
ARi42E01 pGCAP10 GGGTGCCGCATCCCCAGCCCGCCGCCATGGCCGCCTACAAACTGGTGCTGATCCGGCACG
ARi49B01 pGCAP10 GAGCCCGCCGCCATGGCCGCCTACAAACTGGTGCTGATCCGGCACGGCGAGAGCGCATGG
ARi50G11 pGCAP10 GGGGAGCCGGACTGAGCGGTGCGAGCGCGCAGGCGCGGCCGACGGGGCGGGCTGCTACTC
ARi68F03 pGCAP10 GAGTCGGTGCCGCATCCCCAGCCCGCCGCCATGGCCGCCTACAAACTGGTGCTGATCCGG
ARiS013B02 pGCAP10 GAGTCGGTGCCGCATCCCCAGCCCGCCGCCATGGCCGCCTACAAACTGGTGCTGATCCGG
ARiS013B21 pGCAP10 GGTGCCGCATCCCCAGCCCGCCGCCATGGCCGCCTACAAACTGGTGCTGATCCGGCACGG
ARiS020E23 pGCAP10 GCCCAGTCGGTGCCGCATCCCCAGCCCGCCGCCATGGCCGCCTACAAACTGGTGCTGATC
ARiS055H04 pGCAP10 GCCAGTCGGTGCCGCATCCCCAGCCCGCCGCCATGGCCGCCTACAAACTGGTGCTGATCC
ARiS085A12 pGCAP10 GACTGANGGGNGCGAGCCCGCAGGCCCNNCCNACGGGGCGNNCTGNNNCTCCAGAATCTG
ARiS087N10 pGCAP10 GGAGAACTTGCGCGGGAGCCGGACTGAGCGGTGCGAGCGCGCAGGCGCGGCCGACGGGGC
ARiS096L20 pGCAP10 GGCTACTCCGGAATCTGCTAATCCCAGTCGGTGCCGCATCCCCAGCCCGCCGCCATGGCC
ARiS122L15 pGCAP10 GCCCAGCCCGCCGCCATGGCCGCCTACAAACTGGTGCTGATCCGGCACGGCGAGAGCGCA
ARiS122L21 pGCAP10 GAGAACTTGCGCGGGAGCCGGACTGAGCGGTGCGAGCGCGCAGGCGCGGCCGACGGGGCG
ARiS150D06 pGCAP10 GGGACTGAGCGGTGCGAGCGCGCAGGCGCGGCCGACGGGGCGGGCTGCTACTCCGGAATC
ARiS150F18 pGCAP10 GGCTACTCCGGAATCTGCNANTCCCAGTCGGTGCCGCATCCCCAGCCCGCCGCCATGGCC
RBb16F11 pKA1U5 GGCTANTNCGGAATCTGCTAATCNCATTNGGTGCCGCATCCCCAGCCCGCCGNCATGGTC
RBb16F12 pKA1U5 GGCTACTCCGGAATCTGCTAATCCCAGTCGGTGCCGCATCCCCAGCCCGCCGCCATGGCC
RBb17C11 pKA1U5 GATCCCCAGCCCGCCGCCATGGCCGCCTACAAACTGGTGCTGATCCGGCACGGCGAGAGC
RBb60C01 pGCAP1 GAGTCGGTGCCGCATCCCCAGCCCGCCGCCATGGCCGCCTACAAACTGGTGCTGATCCGG
RBd05D01 pGCAP10 GGGGGCGGGCTGCTACTCCGGAATCTGCTAATCCCAGTCGGTGCCGCATCCCCAGCCCGC
RBd31B07 pGCAP10 GAGCCCGCCGCCATGGCCGCCTACAAACTGGTGCTGATCCGGCACGGCGAGAGCGCATGG
RBd69G03 pGCAP10 GGCGGGCTGCTACTCCGGAATCTGCTAATCCCAGTCGGTGCCGCATCCCCAGCCCGCCGC
RBd70G04 pGCAP10 TGAGTCGGTGCCGCATCCCCAGCCCGCCGCCATGGCCGCCTACAAACTGGTGCTGATCCG
RBd82D04 pGCAP10 GACTCCGGAATCTGCTAATCCCAGTCGGTGCCGCATCCCCAGCCCGCCGCCATGGCCGCC
RBd86G01 pGCAP10 GGCTACTCCGGAATCTGCTAATCCCAGTCGGTGCCGCATCCCCAGCCCGCCGCCATGGCC
RBdS014O12 pGCAP10 GAGCCCGCCGCCATGGCCGCCTACAAACTGGTGCTGATCCGGCACGGCGAGAGCGCATGG
RBdS105M18 pGCAP10 TGAGTCGGTGCCGCATCCCCAGCCCGCCGCCATGGCCGCCTACAAACTGGTGCTGATCCG
RBdS154B06 pGCAP10 GGCTACTCCGGAATCTGCTAATCCCAGTCGGTGCCGCATCCCCAGCCCGCCGCCATGGCC
RBdS177O17 pGCAP10 GGCTACTCCGGAATCTGCTAATCCCAGTCGGTGCCGCATCCCCAGCCCGCCGCCATGGCC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl