Prev. |  KEGG KO K01834 > 

RIKEN DNA Bank Human Resource - PGAM1

Gene ID NCBI Gene 5223 |  KEGG hsa:5223
Gene Symbol PGAM1
Protein Name phosphoglycerate mutase 1
Synonyms HEL-S-35|PGAM-B|PGAMA
Ortholog resources KEGG ortholog (KEGG orthology K01834) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY067023 IRAK167J07 pBluescriptR BC066959 NM_002629 Full
HGY080541 IRAL001F21 pOTB7 BC000455 NM_002629.4
HGY090734 IRAL026N22 pOTB7 BC011678 NM_002629 Full
HGY090917 IRAL027E21 pOTB7 BC010038 NM_002629
HGY100353 IRAL050O17 pOTB7 BC062302 NM_002629 Full/var
HGY103484 IRAL058L20 pOTB7 BC073742 NM_002629 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE037544 W01A093O08 pENTR-TOPO IRAL026N22 BC011678 NM_002629  
HGE037550 W01A093O14 pENTR-TOPO IRAL026N22 BC011678 NM_002629  
HGE037552 W01A093O16 pENTR-TOPO IRAL026N22 BC011678 NM_002629  
HGE045957 W01A114O21 pENTR-TOPO IRAL026N22 BC011678 NM_002629  
HGE045959 W01A114O23 pENTR-TOPO IRAL026N22 BC011678 NM_002629  
HGE037416 W01A093I24 pENTR-TOPO IRAL027E21 BC010038 NM_002629  
HGE037448 W01A093K08 pENTR-TOPO IRAL027E21 BC010038 NM_002629  
HGE037452 W01A093K12 pENTR-TOPO IRAL027E21 BC010038 NM_002629  
HGE037456 W01A093K16 pENTR-TOPO IRAL027E21 BC010038 NM_002629  
HGE037462 W01A093K22 pENTR-TOPO IRAL027E21 BC010038 NM_002629  
HGE045937 W01A114O01 pENTR-TOPO IRAL027E21 BC010038 NM_002629  
HGE045941 W01A114O05 pENTR-TOPO IRAL027E21 BC010038 NM_002629  
HGE045947 W01A114O11 pENTR-TOPO IRAL027E21 BC010038 NM_002629  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR041610 ARe04A10 pKA1U5 NM_002629.2  
GGCCGCATCCCCAGCCCGCCGCCATGGCCGCCTACAAACTGGTGCTGATCCGGCACGGCG
HKR044908 ARe12E12 pKA1U5 NM_002629.2  
GAGCCCGCCGCCATGGCCGCCTACAAACTGGTGCTGNTCCGGCACGGCGAGAGCGCATGG
HKR045699 ARe14E03 pKA1U5 NM_002629.2  
ATCCTGGAGTCGGTGCCGCATCCCCAGCCCGCCGCCATGGCCGCCTACAAACTGGTGCTG
HKR052058 ARe30C10 pKA1U5 NM_002629.2  
AGATTTGGGCGAGAACTTGCGCGGGAGCCGGACTGAGCGGTGCGAGCGCGCAGGCGCGGC
HKR063609 ARe59A09 pKA1U5 NM_002629.2  
GTACTCCGGAATCTGCTAATCCCAGTCGGTGCCGCATCCCCAGCCCGCCGCCATGGCCGC
HKR065673 ARe64D01 pKA1U5 NM_002629.2  
GGGTGCCGCATCCCCAGCCCGCCGCCATGGCCGCCTACAAACTGGTGCTGATCCGGCACG
HKR078927 ARe97F07 pKA1U5 NM_002629.2  
TGTGGCGAGCGCGCAGGCGCGGCCGACGGGGCGGGCTGCTACTCCGGAATCTGCTAATCC
HKR160474 ARi01D02 pGCAP10 NM_002629.2  
GGGTGCCGCATCCCCAGCCCGCCGCCATGGCCGCCTACAAACTGGTGCTGATCCGGCACG
HKR164401 ARi11A01 pGCAP10 NM_002629.2  
GGGTGCCGCATCCCCAGCCCGCCGCCATGGCCGCCTACAAACTGGTGCTGATCCGGCACG
HKR167656 ARi19C08 pGCAP10 NM_002629.2  
GAATCCCAGTCGGTGCCGCATCCCCAGCCCGCCGCCATGGCCGCCTACAAACTGGTGCTG
HKR170530 ARi26F10 pGCAP10 NM_002629.2  
GGGACTGAGCGGTGCGAGCGCGCAGGCGCGGCCGACGGGGCGGGCTGCTACTCCGGAATC
HKR171775 ARi29H07 pGCAP10 NM_002629.2  
GATCCCCAGCCCGCCGCCATGGCCGCCTACAAACTGGTGCTGATCCGGCACGGCGAGAGC
HKR174153 ARi35G09 pGCAP10 NM_002629.2  
GGCCGCATCCCCAGCCCGCCGCCATGGCCGCCTACAAACTGGTGCTGATCCGGCACGGCG
HKR175274 ARi38D02 pGCAP10 NM_002629.2  
GGCGGGCTGCTACTCCGGAATCTGCTAATCCCAGTCGGTGCCGCATCCCCAGCCCGCCGC
HKR176897 ARi42E01 pGCAP10 NM_002629.2  
GGGTGCCGCATCCCCAGCCCGCCGCCATGGCCGCCTACAAACTGGTGCTGATCCGGCACG
HKR179625 ARi49B01 pGCAP10 NM_002629.2  
GAGCCCGCCGCCATGGCCGCCTACAAACTGGTGCTGATCCGGCACGGCGAGAGCGCATGG
HKR180155 ARi50G11 pGCAP10 NM_002629.2  
GGGGAGCCGGACTGAGCGGTGCGAGCGCGCAGGCGCGGCCGACGGGGCGGGCTGCTACTC
HKR187323 ARi68F03 pGCAP10 NM_002629.2  
GAGTCGGTGCCGCATCCCCAGCCCGCCGCCATGGCCGCCTACAAACTGGTGCTGATCCGG
HKR205226 ARiS013B02 pGCAP10 NM_002629.2  
GAGTCGGTGCCGCATCCCCAGCCCGCCGCCATGGCCGCCTACAAACTGGTGCTGATCCGG
HKR205245 ARiS013B21 pGCAP10 NM_002629.2  
GGTGCCGCATCCCCAGCCCGCCGCCATGGCCGCCTACAAACTGGTGCTGATCCGGCACGG
HKR208119 ARiS020E23 pGCAP10 NM_002629.2  
GCCCAGTCGGTGCCGCATCCCCAGCCCGCCGCCATGGCCGCCTACAAACTGGTGCTGATC
HKR222172 ARiS055H04 pGCAP10 NM_002629.2  
GCCAGTCGGTGCCGCATCCCCAGCCCGCCGCCATGGCCGCCTACAAACTGGTGCTGATCC
HKR234012 ARiS085A12 pGCAP10 NM_002629.2  
GACTGANGGGNGCGAGCCCGCAGGCCCNNCCNACGGGGCGNNCTGNNNCTCCAGAATCTG
HKR235122 ARiS087N10 pGCAP10 NM_002629.2  
GGAGAACTTGCGCGGGAGCCGGACTGAGCGGTGCGAGCGCGCAGGCGCGGCCGACGGGGC
HKR238684 ARiS096L20 pGCAP10 NM_002629.2  
GGCTACTCCGGAATCTGCTAATCCCAGTCGGTGCCGCATCCCCAGCCCGCCGCCATGGCC
HKR249079 ARiS122L15 pGCAP10 NM_002629.2  
GCCCAGCCCGCCGCCATGGCCGCCTACAAACTGGTGCTGATCCGGCACGGCGAGAGCGCA
HKR249085 ARiS122L21 pGCAP10 NM_002629.2  
GAGAACTTGCGCGGGAGCCGGACTGAGCGGTGCGAGCGCGCAGGCGCGGCCGACGGGGCG
HKR260078 ARiS150D06 pGCAP10 NM_002629.2  
GGGACTGAGCGGTGCGAGCGCGCAGGCGCGGCCGACGGGGCGGGCTGCTACTCCGGAATC
HKR260138 ARiS150F18 pGCAP10 NM_002629.2  
GGCTACTCCGGAATCTGCNANTCCCAGTCGGTGCCGCATCCCCAGCCCGCCGCCATGGCC
HKR326531 RBb16F11 pKA1U5 NM_002629.2  
GGCTANTNCGGAATCTGCTAATCNCATTNGGTGCCGCATCCCCAGCCCGCCGNCATGGTC
HKR326532 RBb16F12 pKA1U5 NM_002629.2  
GGCTACTCCGGAATCTGCTAATCCCAGTCGGTGCCGCATCCCCAGCCCGCCGCCATGGCC
HKR326859 RBb17C11 pKA1U5 NM_002629.2  
GATCCCCAGCCCGCCGCCATGGCCGCCTACAAACTGGTGCTGATCCGGCACGGCGAGAGC
HKR344049 RBb60C01 pGCAP1 NM_002629.2  
GAGTCGGTGCCGCATCCCCAGCCCGCCGCCATGGCCGCCTACAAACTGGTGCTGATCCGG
HKR362073 RBd05D01 pGCAP10 NM_002629.2  
GGGGGCGGGCTGCTACTCCGGAATCTGCTAATCCCAGTCGGTGCCGCATCCCCAGCCCGC
HKR372431 RBd31B07 pGCAP10 NM_002629.2  
GAGCCCGCCGCCATGGCCGCCTACAAACTGGTGCTGATCCGGCACGGCGAGAGCGCATGG
HKR387747 RBd69G03 pGCAP10 NM_002629.2  
GGCGGGCTGCTACTCCGGAATCTGCTAATCCCAGTCGGTGCCGCATCCCCAGCCCGCCGC
HKR388148 RBd70G04 pGCAP10 NM_002629.2  
TGAGTCGGTGCCGCATCCCCAGCCCGCCGCCATGGCCGCCTACAAACTGGTGCTGATCCG
HKR392876 RBd82D04 pGCAP10 NM_002629.2  
GACTCCGGAATCTGCTAATCCCAGTCGGTGCCGCATCCCCAGCCCGCCGCCATGGCCGCC
HKR394545 RBd86G01 pGCAP10 NM_002629.2  
GGCTACTCCGGAATCTGCTAATCCCAGTCGGTGCCGCATCCCCAGCCCGCCGCCATGGCC
HKR405948 RBdS014O12 pGCAP10 NM_002629.2  
GAGCCCGCCGCCATGGCCGCCTACAAACTGGTGCTGATCCGGCACGGCGAGAGCGCATGG
HKR442306 RBdS105M18 pGCAP10 NM_002629.2  
TGAGTCGGTGCCGCATCCCCAGCCCGCCGCCATGGCCGCCTACAAACTGGTGCTGATCCG
HKR461630 RBdS154B06 pGCAP10 NM_002629.2  
GGCTACTCCGGAATCTGCTAATCCCAGTCGGTGCCGCATCCCCAGCCCGCCGCCATGGCC
HKR471153 RBdS177O17 pGCAP10 NM_002629.2  
GGCTACTCCGGAATCTGCTAATCCCAGTCGGTGCCGCATCCCCAGCCCGCCGCCATGGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.07.06

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl