Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00042

HP ID(1) HP00042
Gene ID(2) 5478
Gene Symbol finder PPIA
Protein Name peptidylprolyl isomerase A (cyclophilin A)
RefSeq NM_021130.3
Length of RefSeq (bp) 2276
Chromosome 7p13
Reference DDBJ accession
UniGene Hs.356331

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe02G10 pKA1U5 GGTTTTGCAGACGCCACCGCCGAGGAAAACCGTGCTACTATTAGCCATGGTCAACCCCAC
ARe06H04 pKA1U5 GGCCGTTTTGCAGACGCCACCGCCGAGGAAAACCGTTGNTACTATTAGCCATGGTCAACC
ARe57C06 pKA1U5 GCGTTTTGCAGACGCCACCGCCGAGGAAAACCGTGTACTATTAGCCATGGTCAACCCCAC
ARe63D12 pKA1U5 GGTTTTGCAGACGCCACCGCCGAGGAAAACCGCTGCTACTATTAGCCATGGTCAACCCCA
ARe69H02 pKA1U5 TGTTTTGCAGACGCCACCGCCGAGGAAAACCGTGTACTATTAGCCATGGTCAACCCCACC
ARe77G02 pKA1U5 GGTTTTTTGCAGACGCCACCGCCGAGGAAAACCGCGTTNCTATTAGCCATGGTCAACCCC
ARe79H01 pKA1U5 GGCCGANTTTGCANACGCCACCGCCCGAGGAAAACCGGTGGTACTATTAGCCATGGGTCA
ARe84A11 pKA1U5 GGTTTTTGCAGACGCCACCGCCCGAGGAAAACCGTGTACTATTAGCCATGGTCAACCCCA
ARe87C07 pKA1U5 GGTTTTGCAGACGCCACCGCCGAGGAAAACCGCTGNTACTATTAGCCATGGTCAACCCCA
ARf02E09 pKA1U5 GGTTTTGCAGACGCCACCGCCGAGGAAAACCGTGTACTATTAGCCATGGTCAACCCCACC
ARi04E05 pGCAP10 ATAGGTTTTGCAGACGCCACCGCCGAGGAAACCGTGTACTATTAGCCATGGTCAACCCCA
ARi06A10 pGCAP10 GGTTTTTGCAGACGCCACCGCCGAGGAAACCGTGTACTATTAGCCATGGTCAACCCCACC
ARi09H05 pGCAP10 GGTTTTGCAGACGCCACCGCCGAGGAAAACCGTGTACTATTAGCCATGGTCAACCCCACC
ARi13A02 pGCAP10 GGTTTTGCAGACGCCACCGCCGAGGAAAACCGTGTACTATTAGCCATGGTCAACCCCACC
ARi20C07 pGCAP10 GGTTTTGCAGACGCCACCGCCGAGGAAAACCGTGTACTATTAGCNATGGTCAACCCCACC
ARi22H07 pGCAP10 GGTTTTGCNACGCCCCGCCGAAGAAAACCGTGTACTATTACCCATGGTCAACCCCACCGT
ARi24H08 pGCAP10 GCCGTTTTGCAGACGCCACCGCCGAGGAAAACCGTGTACTATTAGCNATGGTCAACCCCA
ARi31G06 pGCAP10 GGTTTTTGCAGACGCCACCGCCGAGGAAAACCGTGTACTATTAGCCATGGTCAACCCCAC
ARi35G05 pGCAP10 TGGTTTTTTTGCAGACGCCACCGCCGAGGAAAACCGTGTACTATTAGCCATGGTCAACCC
ARi40E10 pGCAP10 GGTTTTGCAGACGCCACCGCCGAGGAAAACCGTGTACTATTAGCCATGGTCAACCCCACC
ARi47B02 pGCAP10 GCCCGTTTTGCAGACGCCACCGCCGAGGAAAACCGTGTACTATTAGCCATGGTCAACCCC
ARi48F09 pGCAP10 GGTTTTTTTTGCAGACGCCACCGCCGAGGAAAACCGTGTACTATTAGCCATGGTCAACCC
ARi54B08 pGCAP10 GCGTTTTTGCAGACGCCACCGCCGAGGAAAACCGTGTACTATTAGCCATGGTCAACCCCA
ARi63E10 pGCAP10 GGTTTTGCAGACGCCACCGCCGAGGAAAACCGTGTACTATTAGCCATGGTCAACCCCACC
ARi65D03 pGCAP10 CCGGTTTTTTGCAGACGCCACCGCCGAGGAAAACCGTGTACTATTAGCCATGGTCAACCC
ARi66C06 pGCAP10 GGTTTTTGCAGACGCCACCGCCGAGGAAAACCGTGTACTATTAGCCATGGTCAACCCCAC
ARi69H12 pGCAP10 GGTTTTGCAGACGCCACCGCCGAGGAAAACCGTGTACTATTAGCCATGGTCAACCCCACC
ARiS008A15 pGCAP10 GGTTTTGCAGACGCCACCGCCGAGGAAAACCGTGTACTATTAGCCATGGTCAACCCCACC
ARiS008F07 pGCAP10 GGTTTTGCAGACGCCACCGCCGAGGAAAACCGTGTACTATTAGCCATGGTCAACCCCACC
ARiS013C14 pGCAP10 GGTTTTGCAGACGCCACCGCCGAGGAAAACCGTGTACTATTAGCCATGGTCAACCCCACC
ARiS013F09 pGCAP10 GGTTTTGCAGACGCCACCGCCGAGGAAAACCGTGTACTATTAGCCATGGTCAACCCCACC
ARiS013I09 pGCAP10 GGTTTTGCAGACGCCCCCGCCGAGGAAAACCGTGTACTATTAGCCATGGTCAACCCCACC
ARiS020N04 pGCAP10 GGTTTTGCAGACGCCACCGCCGAGGAAAACCGTGTACTATTAGCCATGGTCAACCCCACC
ARiS023G14 pGCAP10 GGTTTTTGCAGACGCCACCGCCGAGGAAAACCGTGTACTATTAGCCATGGTCAACCCCAC
ARiS049H10 pGCAP10 TTGTTTTGCAGACGCCACCGCCGAGGAAAACCGTGTACTATTAGCCATGGTCAACCCCAC
ARiS085G05 pGCAP10 GGTTTTGCAGACGCCACCGCCGAGGAAAACCGTGTACTATTAGCCATGGTCAACCCCACC
ARiS109K22 pGCAP10 GCCCGTTTTGCAGACGCCACCGCCGAGGAAAACCGTGTACTATTAGCCATGGTCAACCCC
ARiS109O20 pGCAP10 GGTTTTGCAGACGCCACCGCCGAGGAAAACCGTGTACTATTAGCCATGGTCAACCCCACC
ARiS118A22 pGCAP10 GCGTTTTGCAGACGCCACCGCCGAGGAAAACCGTGTACTATTAGCCATGGTCAACCCCAC
ARiS122C21 pGCAP10 GGTTTTGCAGACGCCACCGCCGAGGAAAACCGTGTACTATTAGCCATGGTCAACCCCACC
ARiS122F24 pGCAP10 GTTTTTTTGCAGACGCCACCGCCGAGGAAAACCGTGTACTATTAGCCATGGTCAACCCCA
ARiS150C23 pGCAP10 GGNCGTTTTGCATACNCCNCCGCCGAGGAAAACCGTGTACTATTANNCATGGNCAACCCC
ARiS150P14 pGCAP10 GCCGTTTTGCAGACGCCACCGCCGAGGAAAACCGTGTACTATTAGCCATGGTCAACCCCA
ARiS191J05 pGCAP10 GTTTTGCAGACGCCACCGCCGAGGAAAACCGTGTACTATTAGCCATGGTCAACCCCACCG
ARiS198F20 pGCAP10
RBb02G04 pKA1U5 GTTTTGCAGACGCCACCGCCGAGGAAAACCGTGTACTATTAGCCATGGTCAACCCCACCG
RBb16A03 pKA1U5 GCCCGTTTTGCAGACGCCACCGCCGAGGAAAACCGTGTACTATTAGCCATGGTCAACCCC
RBb16A07 pKA1U5 GCCCGNTTTTGCAGACGCCACCGCCGAGGAAAACCGTTGTACTATTAGCCATGGTCAACC
RBb41C06 pGCAP1 GCCCGTTTTGCAGACGCCACCGCCGAGGAAAACCGTGTACTATTAGCCATGGTCAACCCC
RBb58A01 pGCAP1 GCCCGTTTTGCAGACGCCACCGCCCGAGGAAAAACCGTGTACTATTAGCCATGGTCAACC
RBd01A10 pGCAP10 GGTTTTGCAGACGCCACCGCCGAGGAAAACCGTGTACTATTAGCCATGGTCAACCCCACC
RBd03D02 pGCAP10 GGTTTTGCAGACGCCACCGCCGAGGAAAACCGTGTACTATTAGCCATGGTCAACCCCACC
RBd14D07 pGCAP10 GCCGTTTTGCAGACGCCACCGCCGAGGAAAACCGTGTACTATTAGCCATGGTCAACCCCA
RBd31H05 pGCAP10 TGGCCGTTTTGCAGACGCCACCGCCGAGGAAAACCGTGTACTATTAGCCATGGTCAACCC
RBd32A11 pGCAP10 GGTTTTGCAGACGCCACCGCCGAGGAAAACCGTGTACTATTAGCCATGGTCAACCCCACC
RBd39A02 pGCAP10 GCGTTTTGCAGACGCCACCGCCGAGGAAAACCGTGTACTATTAGCCATGGTCAACCCCAC
RBd41B03 pGCAP10 GGTTTTGCAGACGCCACCGCCGAGGAAAACCGTGTACTATTAGCCATGGTCAACCCCACC
RBd45B08 pGCAP10 GGTTTTTTGCAGACGCCACCGCCGAGGAAAACCGTGTACTATTAGCCATGGTCAACCCCA
RBd55G04 pGCAP10 GGTTTTGCAGACGCCACCGCCGAGGAAAACCGTGTACTATTAGCCATGGTCAACCCCACC
RBd57E06 pGCAP10 GCCCGTTTTGCAGACGCCACCGCCGAGGAAAACCGTGTACTATTAGCCATGGTCAACCCC
RBd61C12 pGCAP10 GCGTTTTGCAGACGCCACCGCCGAGGAAAACCGTGTACTATTAGCCATGGTCAACCCCAC
RBd61H07 pGCAP10 GACCGCCGAGGAAAACCGTGTACTATTAGCCATGGTCAACCCCACCGTGTTCTTCGACAT
RBd62B01 pGCAP10 GGTTTTGCAGACGCCACCGCCGAGGAAAACCGTGTACTATTAGCCATGGTCAACCCCACC
RBd68F07 pGCAP10 GGTTTTGCAGACGCCACCGCCGAGGAAAACCGTGTACTATTAGCCATGGTCAACCCCACC
RBd83D03 pGCAP10 GTTTTGCAGACGCCACCGCCGAGGAAAACCGTGTACTATTAGCCATGGTCAACCCCACCG
RBd92H02 pGCAP10 GGTTTTTGCAGACGCCACCGCCGAGGAAAACCGTGTACTATTAGCCATGGTCAACCCCAC
RBd95G04 pGCAP10 GGTTTTGCAGACGCCACCGCCGAGGAAAACCGTGTACTATTAGCCATGGTCAACCCCACC
RBd98C12 pGCAP10 GGTTTTGCAGACGCCACCGCCGAGGAAAACCGTGTACTATTAGCCATGGTCAACCCCACC
RBdS013H05 pGCAP10 GGTTTTGCAGACGCCACCGCCGAGGAAAACCGTGTACTATTAGCCATGGTCAACCCCACC
RBdS014N12 pGCAP10 GCGTTTTGCAGACGCCACCGCCGAGGAAAACCGTGTACTATTAGCCATGGTCAACCCCAC
RBdS015C21 pGCAP10 GCCCGTTTTGCAGACGCCACCGCCGAGGAAAACCGTGTACTATTAGCCATGGTCAACCCC
RBdS015E17 pGCAP10 TGGTTTTTTTGCAGACGCCACCGCCGAGGAAAACCGTGTACTATTAGCCATGGTCAACCC
RBdS070D18 pGCAP10 GCGTTTTGCAGACGCCACCGCCGAGGAAAACCGTGTACTATTAGCCATGGTCAACCCCAC
RBdS081N04 pGCAP10 GGTTTTTGCAGACGCCACCGCCGAGGAAAACCGTGTACTATTAGCCATGGTCAACCCCAC
RBdS132I14 pGCAP10 GGTTTTTTTTGCAGACGCCACCGCCGAGGAAAACCGTGTACTATTAGCCATGGTCAACCC
RBdS132L11 pGCAP10 GGTTTTGCAGACGCCACCGCCGAGGAAAACCGTGTACTATTAGCCATGGTCAACCCCACC
RBdS154O10 pGCAP10 GTTTTGCAGACGCCACCGCCGAGGAAAACCGTGTACTATTAGCCATGGTCAACCCCACCG
RBdS177L20 pGCAP10 GGTTTTGCAGACGCCACCGCCGAGGAAAACCGTGTACTATTAGCCATGGTCAACCCCACC
RBdS187F04 pGCAP10 GGTTTTGCAGACGCCACCGCCGAGGAAAACCGTGTACTATTAGCCATGGTCAACCCCACC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl