Prev. |  KEGG KO K03767 > 

RIKEN DNA Bank Human Resource - PPIA

Gene ID NCBI Gene 5478 |  KEGG hsa:5478
Gene Symbol PPIA
Protein Name peptidylprolyl isomerase A
Synonyms CYPA|CYPH|HEL-S-69p
Ortholog resources KEGG ortholog (KEGG orthology K03767) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX069818 IRAK174J02 pCMV-SPORT6 BC073992 NM_203431 Full
HGY082280 IRAL005L16 pOTB7 BC000689 NM_203431 Full
HGY083708 IRAL009E12 pOTB7 BC003026 NM_203431 Full
HGY086783 IRAL016P23 pDNR-LIB BC005320 NM_203431 Full
HGY088631 IRAL021J15 pDNR-LIB BC005982 NM_203431 Full/var
HGY088666 IRAL021L02 pDNR-LIB BC007104 NM_203431 Full/var
HGY092429 IRAL031B05 pDNR-LIB BC013915 NM_203431 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR040954 ARe02G10 pKA1U5 NM_021130.3  
GGTTTTGCAGACGCCACCGCCGAGGAAAACCGTGCTACTATTAGCCATGGTCAACCCCAC
HKR042572 ARe06H04 pKA1U5 NM_021130.3  
GGCCGTTTTGCAGACGCCACCGCCGAGGAAAACCGTTGNTACTATTAGCCATGGTCAACC
HKR062854 ARe57C06 pKA1U5 NM_021130.3  
GCGTTTTGCAGACGCCACCGCCGAGGAAAACCGTGTACTATTAGCCATGGTCAACCCCAC
HKR065284 ARe63D12 pKA1U5 NM_021130.3  
GGTTTTGCAGACGCCACCGCCGAGGAAAACCGCTGCTACTATTAGCCATGGTCAACCCCA
HKR067770 ARe69H02 pKA1U5 NM_021130.3  
TGTTTTGCAGACGCCACCGCCGAGGAAAACCGTGTACTATTAGCCATGGTCAACCCCACC
HKR070946 ARe77G02 pKA1U5 NM_021130.3  
GGTTTTTTGCAGACGCCACCGCCGAGGAAAACCGCGTTNCTATTAGCCATGGTCAACCCC
HKR073611 ARe84A11 pKA1U5 NM_021130.3  
GGTTTTTGCAGACGCCACCGCCCGAGGAAAACCGTGTACTATTAGCCATGGTCAACCCCA
HKR074855 ARe87C07 pKA1U5 NM_021130.3  
GGTTTTGCAGACGCCACCGCCGAGGAAAACCGCTGNTACTATTAGCCATGGTCAACCCCA
HKR080905 ARf02E09 pKA1U5 NM_021130.3  
GGTTTTGCAGACGCCACCGCCGAGGAAAACCGTGTACTATTAGCCATGGTCAACCCCACC
HKR161701 ARi04E05 pGCAP10 NM_021130.3  
ATAGGTTTTGCAGACGCCACCGCCGAGGAAACCGTGTACTATTAGCCATGGTCAACCCCA
HKR162410 ARi06A10 pGCAP10 NM_021130.3  
GGTTTTTGCAGACGCCACCGCCGAGGAAACCGTGTACTATTAGCCATGGTCAACCCCACC
HKR163773 ARi09H05 pGCAP10 NM_021130.3  
GGTTTTGCAGACGCCACCGCCGAGGAAAACCGTGTACTATTAGCCATGGTCAACCCCACC
HKR165202 ARi13A02 pGCAP10 NM_021130.3  
GGTTTTGCAGACGCCACCGCCGAGGAAAACCGTGTACTATTAGCCATGGTCAACCCCACC
HKR168055 ARi20C07 pGCAP10 NM_021130.3  
GGTTTTGCAGACGCCACCGCCGAGGAAAACCGTGTACTATTAGCNATGGTCAACCCCACC
HKR168975 ARi22H07 pGCAP10 NM_021130.3  
GGTTTTGCNACGCCCCGCCGAAGAAAACCGTGTACTATTACCCATGGTCAACCCCACCGT
HKR169776 ARi24H08 pGCAP10 NM_021130.3  
GCCGTTTTGCAGACGCCACCGCCGAGGAAAACCGTGTACTATTAGCNATGGTCAACCCCA
HKR172550 ARi31G06 pGCAP10 NM_021130.3  
GGTTTTTGCAGACGCCACCGCCGAGGAAAACCGTGTACTATTAGCCATGGTCAACCCCAC
HKR174149 ARi35G05 pGCAP10 NM_021130.3  
TGGTTTTTTTGCAGACGCCACCGCCGAGGAAAACCGTGTACTATTAGCCATGGTCAACCC
HKR176106 ARi40E10 pGCAP10 NM_021130.3  
GGTTTTGCAGACGCCACCGCCGAGGAAAACCGTGTACTATTAGCCATGGTCAACCCCACC
HKR178826 ARi47B02 pGCAP10 NM_021130.3  
GCCCGTTTTGCAGACGCCACCGCCGAGGAAAACCGTGTACTATTAGCCATGGTCAACCCC
HKR179329 ARi48F09 pGCAP10 NM_021130.3  
GGTTTTTTTTGCAGACGCCACCGCCGAGGAAAACCGTGTACTATTAGCCATGGTCAACCC
HKR181632 ARi54B08 pGCAP10 NM_021130.3  
GCGTTTTTGCAGACGCCACCGCCGAGGAAAACCGTGTACTATTAGCCATGGTCAACCCCA
HKR185306 ARi63E10 pGCAP10 NM_021130.3  
GGTTTTGCAGACGCCACCGCCGAGGAAAACCGTGTACTATTAGCCATGGTCAACCCCACC
HKR186075 ARi65D03 pGCAP10 NM_021130.3  
CCGGTTTTTTGCAGACGCCACCGCCGAGGAAAACCGTGTACTATTAGCCATGGTCAACCC
HKR186454 ARi66C06 pGCAP10 NM_021130.3  
GGTTTTTGCAGACGCCACCGCCGAGGAAAACCGTGTACTATTAGCCATGGTCAACCCCAC
HKR187780 ARi69H12 pGCAP10 NM_021130.3  
GGTTTTGCAGACGCCACCGCCGAGGAAAACCGTGTACTATTAGCCATGGTCAACCCCACC
HKR203215 ARiS008A15 pGCAP10 NM_021130.3  
GGTTTTGCAGACGCCACCGCCGAGGAAAACCGTGTACTATTAGCCATGGTCAACCCCACC
HKR203327 ARiS008F07 pGCAP10 NM_021130.3  
GGTTTTGCAGACGCCACCGCCGAGGAAAACCGTGTACTATTAGCCATGGTCAACCCCACC
HKR205262 ARiS013C14 pGCAP10 NM_021130.3  
GGTTTTGCAGACGCCACCGCCGAGGAAAACCGTGTACTATTAGCCATGGTCAACCCCACC
HKR205329 ARiS013F09 pGCAP10 NM_021130.3  
GGTTTTGCAGACGCCACCGCCGAGGAAAACCGTGTACTATTAGCCATGGTCAACCCCACC
HKR205401 ARiS013I09 pGCAP10 NM_021130.3  
GGTTTTGCAGACGCCCCCGCCGAGGAAAACCGTGTACTATTAGCCATGGTCAACCCCACC
HKR208316 ARiS020N04 pGCAP10 NM_021130.3  
GGTTTTGCAGACGCCACCGCCGAGGAAAACCGTGTACTATTAGCCATGGTCAACCCCACC
HKR209358 ARiS023G14 pGCAP10 NM_021130.3  
GGTTTTTGCAGACGCCACCGCCGAGGAAAACCGTGTACTATTAGCCATGGTCAACCCCAC
HKR219778 ARiS049H10 pGCAP10 NM_021130.3  
TTGTTTTGCAGACGCCACCGCCGAGGAAAACCGTGTACTATTAGCCATGGTCAACCCCAC
HKR234149 ARiS085G05 pGCAP10 NM_021130.3  
GGTTTTGCAGACGCCACCGCCGAGGAAAACCGTGTACTATTAGCCATGGTCAACCCCACC
HKR243862 ARiS109K22 pGCAP10 NM_021130.3  
GCCCGTTTTGCAGACGCCACCGCCGAGGAAAACCGTGTACTATTAGCCATGGTCAACCCC
HKR243956 ARiS109O20 pGCAP10 NM_021130.3  
GGTTTTGCAGACGCCACCGCCGAGGAAAACCGTGTACTATTAGCCATGGTCAACCCCACC
HKR247222 ARiS118A22 pGCAP10 NM_021130.3  
GCGTTTTGCAGACGCCACCGCCGAGGAAAACCGTGTACTATTAGCCATGGTCAACCCCAC
HKR248869 ARiS122C21 pGCAP10 NM_021130.3  
GGTTTTGCAGACGCCACCGCCGAGGAAAACCGTGTACTATTAGCCATGGTCAACCCCACC
HKR248944 ARiS122F24 pGCAP10 NM_021130.3  
GTTTTTTTGCAGACGCCACCGCCGAGGAAAACCGTGTACTATTAGCCATGGTCAACCCCA
HKR260071 ARiS150C23 pGCAP10 NM_021130.3  
GGNCGTTTTGCATACNCCNCCGCCGAGGAAAACCGTGTACTATTANNCATGGNCAACCCC
HKR260374 ARiS150P14 pGCAP10 NM_021130.3  
GCCGTTTTGCAGACGCCACCGCCGAGGAAAACCGTGTACTATTAGCCATGGTCAACCCCA
HKR276621 ARiS191J05 pGCAP10 NM_021130.3  
GTTTTGCAGACGCCACCGCCGAGGAAAACCGTGTACTATTAGCCATGGTCAACCCCACCG
HKR279340 ARiS198F20 pGCAP10 NM_021130.3  
HKR320948 RBb02G04 pKA1U5 NM_021130.3  
GTTTTGCAGACGCCACCGCCGAGGAAAACCGTGTACTATTAGCCATGGTCAACCCCACCG
HKR326403 RBb16A03 pKA1U5 NM_021130.3  
GCCCGTTTTGCAGACGCCACCGCCGAGGAAAACCGTGTACTATTAGCCATGGTCAACCCC
HKR326407 RBb16A07 pKA1U5 NM_021130.3  
GCCCGNTTTTGCAGACGCCACCGCCGAGGAAAACCGTTGTACTATTAGCCATGGTCAACC
HKR336454 RBb41C06 pGCAP1 NM_021130.3  
GCCCGTTTTGCAGACGCCACCGCCGAGGAAAACCGTGTACTATTAGCCATGGTCAACCCC
HKR343201 RBb58A01 pGCAP1 NM_021130.3  
GCCCGTTTTGCAGACGCCACCGCCCGAGGAAAAACCGTGTACTATTAGCCATGGTCAACC
HKR360410 RBd01A10 pGCAP10 NM_021130.3  
GGTTTTGCAGACGCCACCGCCGAGGAAAACCGTGTACTATTAGCCATGGTCAACCCCACC
HKR361274 RBd03D02 pGCAP10 NM_021130.3  
GGTTTTGCAGACGCCACCGCCGAGGAAAACCGTGTACTATTAGCCATGGTCAACCCCACC
HKR365679 RBd14D07 pGCAP10 NM_021130.3  
GCCGTTTTGCAGACGCCACCGCCGAGGAAAACCGTGTACTATTAGCCATGGTCAACCCCA
HKR372573 RBd31H05 pGCAP10 NM_021130.3  
TGGCCGTTTTGCAGACGCCACCGCCGAGGAAAACCGTGTACTATTAGCCATGGTCAACCC
HKR372811 RBd32A11 pGCAP10 NM_021130.3  
GGTTTTGCAGACGCCACCGCCGAGGAAAACCGTGTACTATTAGCCATGGTCAACCCCACC
HKR375602 RBd39A02 pGCAP10 NM_021130.3  
GCGTTTTGCAGACGCCACCGCCGAGGAAAACCGTGTACTATTAGCCATGGTCAACCCCAC
HKR376427 RBd41B03 pGCAP10 NM_021130.3  
GGTTTTGCAGACGCCACCGCCGAGGAAAACCGTGTACTATTAGCCATGGTCAACCCCACC
HKR378032 RBd45B08 pGCAP10 NM_021130.3  
GGTTTTTTGCAGACGCCACCGCCGAGGAAAACCGTGTACTATTAGCCATGGTCAACCCCA
HKR382148 RBd55G04 pGCAP10 NM_021130.3  
GGTTTTGCAGACGCCACCGCCGAGGAAAACCGTGTACTATTAGCCATGGTCAACCCCACC
HKR382902 RBd57E06 pGCAP10 NM_021130.3  
GCCCGTTTTGCAGACGCCACCGCCGAGGAAAACCGTGTACTATTAGCCATGGTCAACCCC
HKR384460 RBd61C12 pGCAP10 NM_021130.3  
GCGTTTTGCAGACGCCACCGCCGAGGAAAACCGTGTACTATTAGCCATGGTCAACCCCAC
HKR384575 RBd61H07 pGCAP10 NM_021130.3  
GACCGCCGAGGAAAACCGTGTACTATTAGCCATGGTCAACCCCACCGTGTTCTTCGACAT
HKR384825 RBd62B01 pGCAP10 NM_021130.3  
GGTTTTGCAGACGCCACCGCCGAGGAAAACCGTGTACTATTAGCCATGGTCAACCCCACC
HKR387327 RBd68F07 pGCAP10 NM_021130.3  
GGTTTTGCAGACGCCACCGCCGAGGAAAACCGTGTACTATTAGCCATGGTCAACCCCACC
HKR393275 RBd83D03 pGCAP10 NM_021130.3  
GTTTTGCAGACGCCACCGCCGAGGAAAACCGTGTACTATTAGCCATGGTCAACCCCACCG
HKR396970 RBd92H02 pGCAP10 NM_021130.3  
GGTTTTTGCAGACGCCACCGCCGAGGAAAACCGTGTACTATTAGCCATGGTCAACCCCAC
HKR398148 RBd95G04 pGCAP10 NM_021130.3  
GGTTTTGCAGACGCCACCGCCGAGGAAAACCGTGTACTATTAGCCATGGTCAACCCCACC
HKR399260 RBd98C12 pGCAP10 NM_021130.3  
GGTTTTGCAGACGCCACCGCCGAGGAAAACCGTGTACTATTAGCCATGGTCAACCCCACC
HKR405373 RBdS013H05 pGCAP10 NM_021130.3  
GGTTTTGCAGACGCCACCGCCGAGGAAAACCGTGTACTATTAGCCATGGTCAACCCCACC
HKR405924 RBdS014N12 pGCAP10 NM_021130.3  
GCGTTTTGCAGACGCCACCGCCGAGGAAAACCGTGTACTATTAGCCATGGTCAACCCCAC
HKR406069 RBdS015C21 pGCAP10 NM_021130.3  
GCCCGTTTTGCAGACGCCACCGCCGAGGAAAACCGTGTACTATTAGCCATGGTCAACCCC
HKR406113 RBdS015E17 pGCAP10 NM_021130.3  
TGGTTTTTTTGCAGACGCCACCGCCGAGGAAAACCGTGTACTATTAGCCATGGTCAACCC
HKR428090 RBdS070D18 pGCAP10 NM_021130.3  
GCGTTTTGCAGACGCCACCGCCGAGGAAAACCGTGTACTATTAGCCATGGTCAACCCCAC
HKR432716 RBdS081N04 pGCAP10 NM_021130.3  
GGTTTTTGCAGACGCCACCGCCGAGGAAAACCGTGTACTATTAGCCATGGTCAACCCCAC
HKR453006 RBdS132I14 pGCAP10 NM_021130.3  
GGTTTTTTTTGCAGACGCCACCGCCGAGGAAAACCGTGTACTATTAGCCATGGTCAACCC
HKR453075 RBdS132L11 pGCAP10 NM_021130.3  
GGTTTTGCAGACGCCACCGCCGAGGAAAACCGTGTACTATTAGCCATGGTCAACCCCACC
HKR461946 RBdS154O10 pGCAP10 NM_021130.3  
GTTTTGCAGACGCCACCGCCGAGGAAAACCGTGTACTATTAGCCATGGTCAACCCCACCG
HKR471084 RBdS177L20 pGCAP10 NM_021130.3  
GGTTTTGCAGACGCCACCGCCGAGGAAAACCGTGTACTATTAGCCATGGTCAACCCCACC
HKR474924 RBdS187F04 pGCAP10 NM_021130.3  
GGTTTTGCAGACGCCACCGCCGAGGAAAACCGTGTACTATTAGCCATGGTCAACCCCACC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl