Prev. | NRCD Clone U | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00026

HP ID(1) HP00026
Gene ID(2) 7385
Gene Symbol finder UQCRC2
Protein Name ubiquinol-cytochrome c reductase core protein II
RefSeq NM_003366.2
Length of RefSeq (bp) 1674
Chromosome 16p12
Reference DDBJ accession
UniGene Hs.528803

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe20C07 pKA1U5 GCTCCGCCACCATCTTGCTTTCCTTTAATCCGGCAGTGACCGTGNTGTCAGAACAATCTT
ARi09A03 pGCAP10 TGCCCCACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTC
ARiS045I16 pGCAP10 GCTCCGCCACCATCTTGCTTTCCTTTAATCCGGCAGTGACCGTGTGTCAGAACAATCTTG
RBdS015K11 pGCAP10 TTGCTCCGCCACCATCTTGCTTTCCTTTAATCCGGCAGTGACCGTGTGTCAGAACAATCT
RBdS051J11 pGCAP10 GACCATCTTGCTTTCCTTTAATCCGGCAGTGACCGTGTGTCAGAACAATCTTGAATCATG
RBdS105I15 pGCAP10 GATCTTGCTTTCCTTTAATCCGGCAGTGACCGTGTGTCAGAACAATCTTGAATCATGAAG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl