Prev. |  KEGG KO K00415 > 

RIKEN DNA Bank Human Resource - UQCRC2

Gene ID NCBI Gene 7385 |  KEGG hsa:7385
Gene Symbol UQCRC2
Protein Name ubiquinol-cytochrome c reductase core protein 2
Synonyms MC3DN5|QCR2|UQCR2
Featured content Parkinson disease - human
Featured content Huntington disease - human
Featured content Alzheimer disease - human
Ortholog resource in our bank

  UQCRC2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY080428 IRAL001B04 pOTB7 BC000484 NM_003366 Full
HGY083966 IRAL009P06 pOTB7 BC003136 NM_003366 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR048055 ARe20C07 pKA1U5 NM_003366.2  
GCTCCGCCACCATCTTGCTTTCCTTTAATCCGGCAGTGACCGTGNTGTCAGAACAATCTT
HKR163603 ARi09A03 pGCAP10 NM_003366.2  
TGCCCCACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTC
HKR218208 ARiS045I16 pGCAP10 NM_003366.2  
GCTCCGCCACCATCTTGCTTTCCTTTAATCCGGCAGTGACCGTGTGTCAGAACAATCTTG
HKR406251 RBdS015K11 pGCAP10 NM_003366.2  
TTGCTCCGCCACCATCTTGCTTTCCTTTAATCCGGCAGTGACCGTGTGTCAGAACAATCT
HKR420627 RBdS051J11 pGCAP10 NM_003366.2  
GACCATCTTGCTTTCCTTTAATCCGGCAGTGACCGTGTGTCAGAACAATCTTGAATCATG
HKR442207 RBdS105I15 pGCAP10 NM_003366.2  
GATCTTGCTTTCCTTTAATCCGGCAGTGACCGTGTGTCAGAACAATCTTGAATCATGAAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl