Prev. | NRCD Clone N | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00007

HP ID(1) HP00007
Gene ID(2) 4869
Gene Symbol finder NPM1
Protein Name nucleophosmin (nucleolar phosphoprotein B23, numatrin)
RefSeq NM_002520.5
Length of RefSeq (bp) 1373
Chromosome 5q35
Reference DDBJ accession
UniGene Hs.557550

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe11C07 pKA1U5 GCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCGTCC
ARe11H07 pKA1U5 GCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCGTC
ARe12G05 pKA1U5 NNNNNNNNNNNNATCGTCCGCGCGGGTGGTTCTCTGGAGCAGCGTTCTTTTATCTCCGTC
ARe21E03 pKA1U5 GCCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCGT
ARe22E07 pKA1U5 GCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCGTC
ARe29H06 pKA1U5 GCCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCGT
ARe46F04 pKA1U5 ATCCTGCTTTCCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTT
ARe52A04 pKA1U5 GTCCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCG
ARe52D06 pKA1U5 GCCCTGNTGCTGATTCCGTCCTGCGCGGATTGTTCTCTGGAGCAGCGTTCTTTTATCTCC
ARe53G10 pKA1U5 GNCCCAGGGTGGTGCATTCCGGTCCTNCCNCCGGCNTGATTCGTANGNCANCACCNATTC
ARe54B07 pKA1U5 GTCCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCG
ARe61F08 pKA1U5 GCCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCCCTGGAGCAGCGTTCTTTTATCTCCGT
ARe69H01 pKA1U5 GCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCGTCC
ARe73F03 pKA1U5 GCCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCGT
ARe77D12 pKA1U5 GCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCGTC
ARe78B05 pKA1U5 CTTTCCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTC
ARe80D05 pKA1U5 GCCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCGT
ARe85B10 pKA1U5 GCCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCGT
ARe85F04 pKA1U5 GCCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCGT
ARe86B05 pKA1U5 GCTTTCCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCT
ARe94C01 pKA1U5 GCCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCGT
ARe94D02 pKA1U5 GCTTTCCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCT
ARe97F11 pKA1U5 GCTTTTTCTTTCCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTT
ARe98B12 pKA1U5 GCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCGTC
ARi09B02 pGCAP10 GCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCGTCC
ARi12E03 pGCAP10 ACGAAGGCAGTCCAATTAAAGTAACACTGGCAACTTTGAAAATGTCTGTACAGCCAACGG
ARi14C09 pGCAP10 ACGAAGGCAGTCCAATTAAAGTAACACTGGCAACTTTGAAAATGTCTGTACAGCCAACGG
ARi21D01 pGCAP10 TGTCCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCC
ARi21D08 pGCAP10 ACGAAGGCAGTCCAATTAAAGTAACACTGGCAACTTTGAAAATGTCTGTACAGCCAACGG
ARi32G06 pGCAP10 GTCCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCG
ARi33C08 pGCAP10 GCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCGTC
ARi43A12 pGCAP10 GTCCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCG
ARi51H02 pGCAP10 GCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCGTC
ARi58H07 pGCAP10 GCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCGTC
ARi64D10 pGCAP10
ARi67B01 pGCAP10 GCCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCGT
ARiS008L01 pGCAP10 GTCCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCG
ARiS088B02 pGCAP10 GCCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCGT
ARiS088E03 pGCAP10 GTTTCCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTC
ARiS088I04 pGCAP10 GCCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCGT
ARiS109H05 pGCAP10 GCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCGTC
ARiS109L03 pGCAP10 GCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCGTC
ARiS118K14 pGCAP10 GCCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCGT
ARiS150E24 pGCAP10 GCTTTCCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCT
ARiS150I14 pGCAP10 GCCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCGT
ARiS150N16 pGCAP10 GCCCTGGTGTGATTCCNTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCGT
ARiS161F12 pGCAP10 GTCCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCG
ARiS191G24 pGCAP10 GTCCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCG
ARiS191J14 pGCAP10 GCCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCGT
ARiS194E22 pGCAP10 GNCCTGNTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCGT
ARiS194H03 pGCAP10 GCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCGTC
RBb02F08 pKA1U5 GTCCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCG
RBb06B09 pKA1U5 TGCCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCG
RBb14B05 pKA1U5 GCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCGTC
RBb14F12 pKA1U5 GCCCTGGTGTGATTCCGTCCTGCGCGGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCG
RBb14H01 pKA1U5 TGGCCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCC
RBb16B06 pKA1U5 GCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCGTC
RBb18F05 pKA1U5 GCTTTCCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCT
RBb29F08 pGCAP1 GTCCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCG
RBb29F09 pGCAP1 GCCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCGT
RBb32E06 pGCAP1 GCCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCGT
RBb35E02 pGCAP1 TGCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCGTC
RBb36H12 pGCAP1 GTCCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCG
RBb37A06 pGCAP1 GTCCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCG
RBb38A10 pGCAP1 GCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCGTC
RBb38G06 pGCAP1 GCCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCGT
RBb40C09 pGCAP1 GCCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCGT
RBb41E01 pGCAP1 GGTCCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCC
RBb43G06 pGCAP1 GTCCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCG
RBb45F01 pGCAP1 GTCCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCG
RBb49E06 pGCAP1 GCCCCAGGGGTGCATTCCGCTCCTGTCGCGGGTTGCTTCCTCGTGGCANCAGTNGATTCC
RBb52D10 pGCAP1 TTTTTGCCCTGGTGTGATTCCGTCCTGCGCGGTTTGTTCTCTGGAGCAGCGTTCTTTTAT
RBb53A06 pGCAP1 TGTCCCTGGTGGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTC
RBb53B10 pGCAP1 GTCCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTTCTTTTATCTCC
RBb53G10 pGCAP1 GTCCCTGGTGTGATTCCGTCCTGCGCGGTTTGTTCTCTGGAGCAGCGTTCTTTTATCTCC
RBb55C07 pGCAP1 GCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCGTC
RBb58E11 pGCAP1 GTCCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCG
RBb59A05 pGCAP1 GGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCGTCCGC
RBb59E08 pGCAP1 AAATGTGTCCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTA
RBb61H11 pGCAP1 GCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCGTC
RBb67F01 pGCAP1 GCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCGTCC
RBb72C03 pGCAP1 GCCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCGT
RBd02H03 pGCAP10 GCCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCGT
RBd04E01 pGCAP10 GCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCGTC
RBd08B11 pGCAP10 GCCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGATCAGCGTTCTTTTATCTCCGT
RBd30F11 pGCAP10 GGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCGTCCGC
RBd34B03 pGCAP10 GCTTTCCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCT
RBd35H05 pGCAP10 GCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCGTCC
RBd36C08 pGCAP10 GCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCGTC
RBd42A03 pGCAP10 GCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCGTCC
RBd46B08 pGCAP10 GCTTTCCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCT
RBd50H12 pGCAP10 GCTTTCCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCT
RBd65C02 pGCAP10 GCCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCGT
RBd67D03 pGCAP10 GCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCGTC
RBd72A06 pGCAP10 GGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCGTCCGC
RBd75F06 pGCAP10 GCCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCGT
RBd77G09 pGCAP10 GCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCGTC
RBd77G12 pGCAP10 GCTTTCCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCT
RBd83F01 pGCAP10 GCCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCGT
RBd83H10 pGCAP10 GCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCGTC
RBd85A09 pGCAP10 GCCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCGT
RBd89C07 pGCAP10 GCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCGTC
RBd93D06 pGCAP10 GCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCGTC
RBd94D04 pGCAP10 GCCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCGT
RBd95F02 pGCAP10 GTTTTCCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCT
RBd97H06 pGCAP10 GCCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCGT
RBdS007I05 pGCAP10 GCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCGTC
RBdS014M13 pGCAP10 GCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCGTCC
RBdS015K24 pGCAP10 GCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCGTCC
RBdS015M24 pGCAP10 GCCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCGT
RBdS022J03 pGCAP10 GGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCGTCCGCCTT
RBdS040G24 pGCAP10 GCAATGGGTCCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTT
RBdS040K12 pGCAP10 GCCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCGT
RBdS051I03 pGCAP10 GCCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCGT
RBdS075C23 pGCAP10 GCCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCGT
RBdS081A19 pGCAP10 GCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCGTC
RBdS081J03 pGCAP10 GCCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCGT
RBdS104B12 pGCAP10 GCCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCGT
RBdS104M06 pGCAP10 GCCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCGT
RBdS105F09 pGCAP10 GCCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCGT
RBdS154M12 pGCAP10 GCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCGTCC
RBdS154O05 pGCAP10 GCCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCGT
RBdS156P12 pGCAP10 GCCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCGT
RBdS187A04 pGCAP10 TGCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCGT
RBdS187A20 pGCAP10 GCCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCGT
RBdS187F02 pGCAP10 GCCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCGT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl