Prev. | Human A to Z list > N > 

RIKEN DNA Bank Human Resource - NPM1

Gene ID (NCBI) 4869
Gene Symbol NPM1
Protein Name nucleophosmin (nucleolar phosphoprotein B23, numatrin)
Synonyms B23|NPM
Databases KEGG link 01 |  NCBI Gene link 01


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX005636 IRAK014B12 pCMV-SPORT6 BC009623 NM_199185 Full
HGX044119 IRAK110E23 pCMV-SPORT6 BC050628 NM_002520 Full
HGY080542 IRAL001F22 pOTB7 BC002398 NM_002520 Full
HGY086675 IRAL016L11 pDNR-LIB BC003670 NM_002520 Partial
HGY087712 IRAL019E16 pDNR-LIB BC012566 NM_002520 Full/var
HGY088564 IRAL021G20 pDNR-LIB BC008495 NM_002520 Full
HGY092401 IRAL031A01 pDNR-LIB BC014349 NM_002520 Full
HGY092542 IRAL031F22 pDNR-LIB BC021668 NM_002520 Full
HGY092877 IRAL032D05 pDNR-LIB BC016824 NM_002520 Full
HGY092881 IRAL032D09 pDNR-LIB BC021983 NM_002520 Full/var
HGY093061 IRAL032K21 pDNR-LIB BC016768 NM_002520 Full/var
HGY093137 IRAL032O01 pDNR-LIB BC016716 NM_002520 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


Genome Network Project (GNP) Gateway® Entry Clone link 01

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA
Clone ID Sequence (DDBJ)
HGE113211 M01C083A11 pDONR221 IMS05-A06 BC009623 NM_199185
HGE113259 M01C083C11 pDONR221 IMS05-A06 BC009623 NM_199185
HGE113307 M01C083E11 pDONR221 IMS05-A06 BC009623 NM_199185
HGE113355 M01C083G11 pDONR221 IMS05-A06 BC009623 NM_199185
HGE113403 M01C083I11 pDONR221 IMS05-A06 BC009623 NM_199185
HGE113451 M01C083K11 pDONR221 IMS05-A06 BC009623 NM_199185
HGE113499 M01C083M11 pDONR221 IMS05-A06 BC009623 NM_199185
HGE113547 M01C083O11 pDONR221 IMS05-A06 BC009623 NM_199185

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1)
5'-terminal sequence(2)
HKR163626 ARi09B02 pGCAP10 NM_002520.5
GCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCGTCC
HKR044455 ARe11C07 pKA1U5 NM_002520.5
GCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCGTCC
HKR044575 ARe11H07 pKA1U5 NM_002520.5
GCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCGTC
HKR044949 ARe12G05 pKA1U5 NM_002520.5
NNNNNNNNNNNNATCGTCCGCGCGGGTGGTTCTCTGGAGCAGCGTTCTTTTATCTCCGTC
HKR164899 ARi12E03 pGCAP10 NM_002520.5
ACGAAGGCAGTCCAATTAAAGTAACACTGGCAACTTTGAAAATGTCTGTACAGCCAACGG
HKR165657 ARi14C09 pGCAP10 NM_002520.5
ACGAAGGCAGTCCAATTAAAGTAACACTGGCAACTTTGAAAATGTCTGTACAGCCAACGG
HKR048499 ARe21E03 pKA1U5 NM_002520.5
GCCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCGT
HKR048903 ARe22E07 pKA1U5 NM_002520.5
GCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCGTC
HKR051774 ARe29H06 pKA1U5 NM_002520.5
GCCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCGT
HKR168473 ARi21D01 pGCAP10 NM_002520.5
TGTCCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCC
HKR168480 ARi21D08 pGCAP10 NM_002520.5
ACGAAGGCAGTCCAATTAAAGTAACACTGGCAACTTTGAAAATGTCTGTACAGCCAACGG
HKR172950 ARi32G06 pGCAP10 NM_002520.5
GTCCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCG
HKR173256 ARi33C08 pGCAP10 NM_002520.5
GCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCGTC
HKR058524 ARe46F04 pKA1U5 NM_002520.5
ATCCTGCTTTCCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTT
HKR177212 ARi43A12 pGCAP10 NM_002520.5
GTCCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCG
HKR060804 ARe52A04 pKA1U5 NM_002520.5
GTCCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCG
HKR060878 ARe52D06 pKA1U5 NM_002520.5
GCCCTGNTGCTGATTCCGTCCTGCGCGGATTGTTCTCTGGAGCAGCGTTCTTTTATCTCC
HKR061354 ARe53G10 pKA1U5 NM_002520.5
GNCCCAGGGTGGTGCATTCCGGTCCTNCCNCCGGCNTGATTCGTANGNCANCACCNATTC
HKR061631 ARe54B07 pKA1U5 NM_002520.5
GTCCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCG
HKR180570 ARi51H02 pGCAP10 NM_002520.5
GCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCGTC
HKR183375 ARi58H07 pGCAP10 NM_002520.5
GCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCGTC
HKR064528 ARe61F08 pKA1U5 NM_002520.5
GCCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCCCTGGAGCAGCGTTCTTTTATCTCCGT
HKR067769 ARe69H01 pKA1U5 NM_002520.5
GCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCGTCC
HKR185682 ARi64D10 pGCAP10 NM_002520.5
HKR186825 ARi67B01 pGCAP10 NM_002520.5
GCCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCGT
HKR069323 ARe73F03 pKA1U5 NM_002520.5
GCCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCGT
HKR070884 ARe77D12 pKA1U5 NM_002520.5
GCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCGTC
HKR071229 ARe78B05 pKA1U5 NM_002520.5
CTTTCCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTC
HKR072077 ARe80D05 pKA1U5 NM_002520.5
GCCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCGT
HKR074034 ARe85B10 pKA1U5 NM_002520.5
GCCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCGT
HKR074124 ARe85F04 pKA1U5 NM_002520.5
GCCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCGT
HKR074429 ARe86B05 pKA1U5 NM_002520.5
GCTTTCCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCT
HKR077649 ARe94C01 pKA1U5 NM_002520.5
GCCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCGT
HKR077674 ARe94D02 pKA1U5 NM_002520.5
GCTTTCCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCT
HKR078931 ARe97F11 pKA1U5 NM_002520.5
GCTTTTTCTTTCCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTT
HKR079236 ARe98B12 pKA1U5 NM_002520.5
GCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCGTC
HKR203465 ARiS008L01 pGCAP10 NM_002520.5
GTCCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCG
HKR235226 ARiS088B02 pGCAP10 NM_002520.5
GCCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCGT
HKR235299 ARiS088E03 pGCAP10 NM_002520.5
GTTTCCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTC
HKR235396 ARiS088I04 pGCAP10 NM_002520.5
GCCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCGT
HKR243773 ARiS109H05 pGCAP10 NM_002520.5
GCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCGTC
HKR243867 ARiS109L03 pGCAP10 NM_002520.5
GCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCGTC
HKR247454 ARiS118K14 pGCAP10 NM_002520.5
GCCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCGT
HKR260120 ARiS150E24 pGCAP10 NM_002520.5
GCTTTCCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCT
HKR260206 ARiS150I14 pGCAP10 NM_002520.5
GCCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCGT
HKR260328 ARiS150N16 pGCAP10 NM_002520.5
GCCCTGGTGTGATTCCNTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCGT
HKR264532 ARiS161F12 pGCAP10 NM_002520.5
GTCCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCG
HKR276568 ARiS191G24 pGCAP10 NM_002520.5
GTCCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCG
HKR276630 ARiS191J14 pGCAP10 NM_002520.5
GCCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCGT
HKR277718 ARiS194E22 pGCAP10 NM_002520.5
GNCCTGNTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCGT
HKR277771 ARiS194H03 pGCAP10 NM_002520.5
GCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCGTC
HKR320928 RBb02F08 pKA1U5 NM_002520.5
GTCCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCG
HKR322433 RBb06B09 pKA1U5 NM_002520.5
TGCCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCG
HKR360971 RBd02H03 pGCAP10 NM_002520.5
GCCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCGT
HKR361697 RBd04E01 pGCAP10 NM_002520.5
GCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCGTC
HKR363235 RBd08B11 pGCAP10 NM_002520.5
GCCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGATCAGCGTTCTTTTATCTCCGT
HKR325629 RBb14B05 pKA1U5 NM_002520.5
GCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCGTC
HKR325732 RBb14F12 pKA1U5 NM_002520.5
GCCCTGGTGTGATTCCGTCCTGCGCGGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCG
HKR325769 RBb14H01 pKA1U5 NM_002520.5
TGGCCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCC
HKR326430 RBb16B06 pKA1U5 NM_002520.5
GCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCGTC
HKR327325 RBb18F05 pKA1U5 NM_002520.5
GCTTTCCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCT
HKR331728 RBb29F08 pGCAP1 NM_002520.5
GTCCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCG
HKR331729 RBb29F09 pGCAP1 NM_002520.5
GCCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCGT
HKR332902 RBb32E06 pGCAP1 NM_002520.5
GCCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCGT
HKR334098 RBb35E02 pGCAP1 NM_002520.5
TGCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCGTC
HKR334580 RBb36H12 pGCAP1 NM_002520.5
GTCCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCG
HKR334806 RBb37A06 pGCAP1 NM_002520.5
GTCCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCG
HKR335210 RBb38A10 pGCAP1 NM_002520.5
GCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCGTC
HKR335350 RBb38G06 pGCAP1 NM_002520.5
GCCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCGT
HKR372131 RBd30F11 pGCAP10 NM_002520.5
GGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCGTCCGC
HKR373627 RBd34B03 pGCAP10 NM_002520.5
GCTTTCCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCT
HKR374173 RBd35H05 pGCAP10 NM_002520.5
GCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCGTCC
HKR374456 RBd36C08 pGCAP10 NM_002520.5
GCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCGTC
HKR336057 RBb40C09 pGCAP1 NM_002520.5
GCCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCGT
HKR336497 RBb41E01 pGCAP1 NM_002520.5
GGTCCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCC
HKR337350 RBb43G06 pGCAP1 NM_002520.5
GTCCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCG
HKR338121 RBb45F01 pGCAP1 NM_002520.5
GTCCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCG
HKR339702 RBb49E06 pGCAP1 NM_002520.5
GCCCCAGGGGTGCATTCCGCTCCTGTCGCGGGTTGCTTCCTCGTGGCANCAGTNGATTCC
HKR376803 RBd42A03 pGCAP10 NM_002520.5
GCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCGTCC
HKR378432 RBd46B08 pGCAP10 NM_002520.5
GCTTTCCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCT
HKR340882 RBb52D10 pGCAP1 NM_002520.5
TTTTTGCCCTGGTGTGATTCCGTCCTGCGCGGTTTGTTCTCTGGAGCAGCGTTCTTTTAT
HKR341206 RBb53A06 pGCAP1 NM_002520.5
TGTCCCTGGTGGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTC
HKR341234 RBb53B10 pGCAP1 NM_002520.5
GTCCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTTCTTTTATCTCC
HKR341354 RBb53G10 pGCAP1 NM_002520.5
GTCCCTGGTGTGATTCCGTCCTGCGCGGTTTGTTCTCTGGAGCAGCGTTCTTTTATCTCC
HKR342055 RBb55C07 pGCAP1 NM_002520.5
GCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCGTC
HKR343307 RBb58E11 pGCAP1 NM_002520.5
GTCCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCG
HKR343605 RBb59A05 pGCAP1 NM_002520.5
GGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCGTCCGC
HKR343704 RBb59E08 pGCAP1 NM_002520.5
AAATGTGTCCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTA
HKR380180 RBd50H12 pGCAP10 NM_002520.5
GCTTTCCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCT
HKR344579 RBb61H11 pGCAP1 NM_002520.5
GCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCGTC
HKR346921 RBb67F01 pGCAP1 NM_002520.5
GCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCGTCC
HKR386050 RBd65C02 pGCAP10 NM_002520.5
GCCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCGT
HKR386875 RBd67D03 pGCAP10 NM_002520.5
GCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCGTC
HKR348851 RBb72C03 pGCAP1 NM_002520.5
GCCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCGT
HKR388806 RBd72A06 pGCAP10 NM_002520.5
GGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCGTCCGC
HKR390126 RBd75F06 pGCAP10 NM_002520.5
GCCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCGT
HKR390953 RBd77G09 pGCAP10 NM_002520.5
GCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCGTC
HKR390956 RBd77G12 pGCAP10 NM_002520.5
GCTTTCCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCT
HKR393321 RBd83F01 pGCAP10 NM_002520.5
GCCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCGT
HKR393378 RBd83H10 pGCAP10 NM_002520.5
GCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCGTC
HKR394009 RBd85A09 pGCAP10 NM_002520.5
GCCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCGT
HKR395655 RBd89C07 pGCAP10 NM_002520.5
GCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCGTC
HKR397278 RBd93D06 pGCAP10 NM_002520.5
GCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCGTC
HKR397676 RBd94D04 pGCAP10 NM_002520.5
GCCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCGT
HKR398122 RBd95F02 pGCAP10 NM_002520.5
GTTTTCCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCT
HKR398974 RBd97H06 pGCAP10 NM_002520.5
GCCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCGT
HKR402997 RBdS007I05 pGCAP10 NM_002520.5
GCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCGTC
HKR405901 RBdS014M13 pGCAP10 NM_002520.5
GCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCGTCC
HKR406264 RBdS015K24 pGCAP10 NM_002520.5
GCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCGTCC
HKR406312 RBdS015M24 pGCAP10 NM_002520.5
GCCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCGT
HKR409019 RBdS022J03 pGCAP10 NM_002520.5
GGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCGTCCGCCTT
HKR416168 RBdS040G24 pGCAP10 NM_002520.5
GCAATGGGTCCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTT
HKR416252 RBdS040K12 pGCAP10 NM_002520.5
GCCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCGT
HKR420595 RBdS051I03 pGCAP10 NM_002520.5
GCCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCGT
HKR430071 RBdS075C23 pGCAP10 NM_002520.5
GCCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCGT
HKR432419 RBdS081A19 pGCAP10 NM_002520.5
GCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCGTC
HKR432619 RBdS081J03 pGCAP10 NM_002520.5
GCCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCGT
HKR441636 RBdS104B12 pGCAP10 NM_002520.5
GCCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCGT
HKR441894 RBdS104M06 pGCAP10 NM_002520.5
GCCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCGT
HKR442129 RBdS105F09 pGCAP10 NM_002520.5
GCCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCGT
HKR461900 RBdS154M12 pGCAP10 NM_002520.5
GCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCGTCC
HKR461941 RBdS154O05 pGCAP10 NM_002520.5
GCCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCGT
HKR462772 RBdS156P12 pGCAP10 NM_002520.5
GCCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCGT
HKR474804 RBdS187A04 pGCAP10 NM_002520.5
TGCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCGT
HKR474820 RBdS187A20 pGCAP10 NM_002520.5
GCCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCGT
HKR474922 RBdS187F02 pGCAP10 NM_002520.5
GCCCTGGTGTGATTCCGTCCTGCGCGGTTGTTCTCTGGAGCAGCGTTCTTTTATCTCCGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.08.02

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_160505.pl