ARiS118A16 - NRCD Human cDNA Clone

Catalog Number HKR247216 Clone Name ARiS118A16 Clone info. Plasmid clone of human ANLN cDNA with SV40 promoter Vector(1) pGCAP10 5'-terminal sequence(2) TGGCCGAGTCCGTCACTGGAAGCCGAGAGGAGAGGACAGCTGGTTGTGGGAGAGTTCCCC Sequence, submitted(3) n.a. Note Currently known difference between NM_018685.3: Substitution G to A at 775 nt, Insertion of CTT between 1103-1104 nt, Deletion of 2078-2089 nt, Insertion of A between 4384-4385 nt.   Sequence, refered NM_018685.2 (NCBI RefSeq mRNA) Gene Symbol and ID(4) ANLN (NCBI Gene 54443)  other clone of ANLN in our bank Synonyms FSGS8|Scraps|scra Protein Name anillin, actin binding protein

Links   KEGG   NCBI Gene   NCBI RefSeq

(1) Please refer below or Vector Backbone at NRCD Human cDNA Clone HP.
pKA1U5 (accession no. AB191256 (map of pKA1U5)
pGCAP1 (accession no. AB191257 (map of pGCAP1)
pGCAP10 (accession no. AB371573 (map of pGCAP10)
(2) 5' terminal sequence of insert provided by the depositor.
(3) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).
(4) Gene ID was determined by the 5' terminal sequence by the depositor.

Please note that the information was bioinformatically annotated and that this information may not reflect the most recent annotation of the reference sequence. You should carefully check the insert sequence provided by us to make sure that it matches the sequence you expect.

Distribution information

Plasmid request [in Japanese] [in English]

How to cite this biological resource

Materials & Methods section:

Sequence information

Full length sequence and restriction map are not available.

This clone has been sequenced a portion and digested by restriction enzyme for verification. Results are available as below!

References and tips

Featured content

Reference

2023.07.07